| Abstract: | This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans. |
