Effects of Feed Type and Temperature on Growth of Juvenile Abalone,Haliotis discus hannai Ino

Effects of feed type and temperature on growth and body composition of juvenile abalone, Haliotis discus hannai Ino, were determined. A 2 (feed types: formulated diet and dry sea tangle) × 3 (temperature conditions: 20, 23 and 26 C) factorial design with triplicate was used. Seventy juvenile abalone averaging 4.7 g were randomly distributed into each of 18, 50‐L plastic rectangular containers. Six containers were placed into each temperature condition of three 1.3 ton concrete flow‐through raceway systems. Abalone were daily fed with either the formulated diet or dry sea tangle once a day to satiation level. Survival was affected by feed type, but not by temperature. Weight gain of abalone was affected by both feed type and temperature. Regardless of temperature, weight gain of abalone fed the formulated diet was better than that of abalone fed the dry sea tangle. Shell length and width were affected by feed type, but not by temperature. In conclusion, weight gain of abalone was affected by both feed type and temperature, but feed type had a stronger effect than temperature. The formulated diet achieved better growth of abalone than the dry sea tangle regardless of temperature and 20 C seemed to be recommendable for abalone among temperature tested.     

An outbreak of adenoviral infection in inland bearded dragons (Pogona vitticeps) coinfected with dependovirus and coccidial protozoa (Isospora sp.).

Thirty of 200 (15%) hatchling inland bearded dragons were found dead after a short period (48 hours) of weakness and lethargy. The most common clinical signs were head tilt and circling. Six bearded dragons with neurological signs were euthanized, and postmortem examination revealed no gross abnormalities. Microscopically, severe, randomly distributed hepatocellular necrosis with large basophilic intranuclear inclusion bodies in numerous hepatocytes was noted. Small-intestinal enterocytes contained intracytoplasmic coccidial protozoa (Isospora sp.) and occasional enterocytes had basophilic intranuclear inclusion bodies. Transmission electron microscopy revealed both 80- and 20-nm-diameter viral particles, which were consistent with adenoviruses and dependoviruses, respectively. Adenoviral outbreaks in groups of animals are uncommon. An adverse synergistic effect of the coccidiosis with the adenoviral infection may have played a critical role in the high morbidity and mortality in this case.     

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. This revised version was published online in August 2006 with corrections to the Cover Date.     

Mapping QTLs related to salinity tolerance of rice at the young seedling stage

Using a population of recombinant inbred lines of the 164 genotypes derived from a cross between ‘Milyang 23’ (indica) and ‘Gihobyeo’ (japonica) in rice (Oryza sativa L.), salt tolerance was evaluated at a young seedling stage in concentrations of 0.5% and 0.7% NaCl. Mapping quantitative trait loci (QTLs) related to salt tolerance was carried out by interval mapping using Qgene 3.0. Two QTLs (qST1 and qST3) conferring salt tolerance at young seedling stage were mapped on chromosome 1 and 3, respectively, and explained 35.5–36.9% of the total phenotypic variation in 0.5% and 0.7% NaCl. The favourable allele of qST1 was contributed by ‘Gihobyeo’, and that of qST3 by ‘Milyang 23’. The results obtained in 0.5% and 0.7% NaCl for 2 years were similar in flanked markers and phenotypic variation.     

Germinated Wheat: Phytochemical Composition and Mixing Characteristics

Germinated grain has been gaining popularity owing to its beneficial effect on human health. In this research, whole wheat samples obtained after three days and five days of germination were analyzed for biochemical components and mixing characteristics. Three days of germination caused severe initial degradation of SDS‐insoluble glutenin macropolymers, which was accompanied by deterioration of mixing characteristics. Proteolysis during germination resulted in a significant increase of free amino acid concentration. For example, free asparagine concentration increased significantly after five days of germination. γ‐Aminobutyric acid concentration, which was undetectable in nongerminated grain, also increased substantially during germination. Phenolic concentration and antioxidant activity level were elevated exponentially during germination, showing a high linear correlation between them (r = 0.999, P < 0.05). These findings indicate that germinated wheat flour may be a valuable ingredient for functional foods because of its increased levels of certain phytochemical components that are beneficial to human health.     

In Vitro Study on Effect of Germinated Wheat on Human Breast Cancer Cells

This research investigated the possible anticancer effects of germinated wheat flour (GWF) on growth and apoptosis of human breast cancer cells. In a series of in vitro experiments, estrogen‐receptor‐positive (MCF‐7) and ‐negative (MDA‐MB‐231) cells were cultured and treated with GWF that was obtained after a three‐day germination. The GWF significantly reduced the growth of both of MCF‐7 and MDA‐MB‐231 cells. In analysis with a flow cytometer, the GWF significantly up‐regulated apoptosis of both cell lines. These results indicate that GWF induced apoptosis and inhibited growth of the human breast cell lines, thereby demonstrating its potential inhibition of breast cancer cell proliferation.     

Effects of Dietary Protein and Energy Levels on Growth and Body Composition of Juvenile Flounder Paralichthys olivaceus

A feeding trial of three protein levels (30, 40 and 50%) and two energy levels (300 and 400 kcal/100-g diet) factorial design with three replications was carried out to investigate the proper dietary protein and energy levels for the growth of juvenile flounder Paralichthys olivaceus . Weight gain of fish tended to improve with increasing dietary protein level. Weight gain of fish fed either the 40% or 50% protein diet with 300 kcal/100-g diet was significantly higher ( P < 0.05) than with 400 kcal/100-g diet. The best weight gain was obtained from fish fed the 50% protein diet with 300 kcal/100-g diet. Feed efficiency tended to improve with increasing dietary protein level. However, dietary energy level had no significant effect on feed efficiency of fish fed the 30% or 50% protein diet, but that of fish fed the 40% protein diet with 300 kcal/100-g diet was significantly higher than with 400 kcal/100-g diet. Protein retention tended to increase as dietary protein level increased and energy level decreased. Lipid content of fish fed the diet containing 400 kcal/100-g diet was significantly higher than that of fish fed the diet containing 300 kcal/100-g diet at all protein levels. Fatty acid compositions such as linoleic acid, EPA (20:5n-3) and DHA (22:6n-3) offish were directly affected by dietary lipid (squid liver oil and/or soybean oil) used for energy source. Based on the above results, it can be concluded that the proper dietary protein and energy levels for the growth of juvenile flounder are 50% and 300 kcal/100-g diet, respectively.     

Compensatory Growth of Juvenile Flounder Paralichthys olivaceus L. and Changes in Biochemical Composition and Body Condition Indices during Starvation and after Refeeding in Winter Season

Compensatory growth and changes in biochemical composition, hematocrit and body condition indices of juvenile flounder Paralichthys olivaceus were assessed during starvation and after refeeding. Twenty juvenile fish were stocked into each 200‐L flow‐through tank to give five treatments with three replicates per treatment: control group fish (C) were hand fed to apparent satiation twice daily for 8 wk, whereas the Sl, S2, S3, and S4 fish were hand fed to apparent satiation twice daily for 7, 6, 5, and 4 wk after 1, 2, 3, and 4 wk of starvation, respectively. During starvation, weight decreased linearly with periods of feed deprivation up to 3 wk. Survival was not significantly different among treatments. At the end of the feeding trial, weight gain (g/fish) and specific growth rate (SGR) of flounder in S2 was significantly (P < 0.05) higher than those of fish in S3 or S4, but not significantly different from those of fish in C or Sl. Feed consumption of flounder (g/fish) was proportional to duration of feeding except for that of fish in S2. Feed efficiency ratio (FER) and protein efficiency ratio (PER) values for flounder in S2 were significantly (P < 0.05) higher than those for fish in C, but not significantly different from those for fish in Sl, S3, or S4. During starvation, hepatosomatic index (HSI) and lipid content of flounder without liver decreased with periods of feed deprivation. However, HSI and condition factor (CF) for flounder in S2 were significantly (P < 0.05) higher than those for fish in Sl, S3, S4 and C except for CF in Sl at the end of the feeding trial. Proximate composition of flounder without the liver was not significantly different among treatments at the end of the feeding trial. In considering above results, juvenile flounder achieved compensatory growth with up to 2‐wk feed deprivation. Compensatory growth of flounder fed for 6 wk after 2‐wk feed deprivation was well supported by improvement in SGR, FER, and PER. HSI could be a good index to monitor changes in body condition during starvation and after refeeding.     

Psychoacoustic characteristics of fibers

In order to investigate psychoacoustic characteristics of fibers, and to compare them with sound physical parameters, each sound of 25 different fabrics consisted of a single fiber such as wool, cotton, silk, polyester, and nylon was recorded. Sounds of specimens were transformed into critical band diagram and psychoacoustic characteristics including loudness and sharpness for each sound were calculated based on Zwicker’s models. Physical parameters such as the level pressure of total sound (LPT), level ranges (ΔL), frequency differences (Δf), AR coefficients (ARC, ARF, ARE) were obtained in fast fourier transform (FFT) spectrum. Nylon taffeta showed higher values for loudness than 2.5 sone corresponding to human low conversation, while most silk fibers generated less louder showing lower values for loudness than 1.0 sone. Wool fibers had higher loudness mean value than that of cotton, while the two fibers didn’t differ in LPT. Loudness showed high positive correlation coefficients with both LPT and ARC. Sharpness values were higher for wool fiber group than other fibers. Sharpness was not concerned with loudness, LPT, and ARC, but the fabrics with higher values for sharpness tended to show higherΔL.     

Combining ability of seed vigor and seed yield in soybean

Studies have shown no consensus in relationships between seed yield and vigor in soybean [Glycine max (L.) Merrill]. The lack of information regarding the inheritance of seed vigor prompted this study to determine the types of gene action and combining ability estimates for seed vigor and its related traits. Five high and six low seed vigor soybean genotypes were crossed in a diallel, and selfed to produce 55 F₂ progenies, which were examined, along with the parents, for seed vigor, yield, and seed weight. Significant genotype and environment effects were found for seed vigor and yield. General combining ability (GCA) effects for seed vigor and seed yield were significant (p≤ 0.01) and larger than specific combining ability (SCA) effects. Significant GCA and SCA effects were found for seed weight, indicating that both additive and non additive genetic effects were involved in conditioning seed weight. The ratios of mean square, 2GCA / (2GCA+SCA), were 0.96 for seed vigor and 0.93 for seed yield. These ratios indicated that additive gene effects were more important than non additive gene effects for seed vigor and seed yield in these crosses. Mean seed vigor(83.8%), as determined by accelerated aging germination, and mean seed yield (2,155 kg ha^-1)in high vigor × high vigor crosses were higher than the high vigor × low vigor and low vigor × low vigor crosses. Mean percent accelerated aging germination rates in F₂ populations from diallel crosses were significantly related to mid-parent seed vigor(r² = 0.52^**) and midparent seed size (r² = 0.31^**). These results indicated that levels of seed vigor can be improved through breeding, while maintaining high yields because of the predominance of GCA effects in both seed vigor and seed yield. This revised version was published online in July 2006 with corrections to the Cover Date.