The production and characterization of anti-bovine CD14 monoclonal antibodies

To characterize further the chemical and biological properties of bovine soluble (bos) CD14, a panel of ten murine monoclonal antibodies (mAb) reactive with recombinant (r) bosCD14 were produced. A sandwich ELISA, using murine mAb and rabbit polyclonal antibodies reactive with rbosCD14 was developed. All the mAb were reactive by ELISA with baculovirus-derived rbosCD14 and they recognized rbosCD14 (40 kDa) by western blot analysis. The mAb also identified by western blot sCD14 (53 and 58 kDa) in milk and blood and sCD14 (47 kDa) in a lysate of macrophages obtained from involuted bovine mammary gland secretions. Analysis by ELISA of whey samples after intramammary injection of lipopolysaccharide (LPS) (10 micro g) revealed increased sCD14 levels between 8 to 48 h after injection. Flow cytometric analysis showed that the mAb bound to macrophages isolated from involuted mammary gland secretions and mouse macrophages but not to swine or horse monocytes. Addition of anti-rbosCD14 mAb to monocytes stimulated with LPS reduced in vitro production of TNF-alpha. The anti-rbosCD14 antibodies generated in this study will be useful in studying CD14, an accessory molecule that contributes to host innate recognition of bacterial cell wall components in mammary secretions produced during mastitis.     

Molecular mapping of a quantitative trait locus qSTV11Z harbouring rice stripe virus resistance gene,Stv‐b

Rice stripe virus (RSV) predominantly affects rice. In this study, we attempted to localize the quantitative trait locus (QTL) conferring RSV resistance in the ‘Zenith’ variety, which is known to harbour Stv‐a and Stv‐b. The resistant variety Zenith was crossed with the susceptible variety ‘Ilpum’ to generate a mapping population comprising 180 F_2:3 lines for QTL analysis. Contrary to previous findings, we could not detect Stv‐a‐specific QTLs on chromosome 6. Stv‐b‐specific QTL was detected on the long arm of chromosome 11; it was designated qSTV11^z. Six F_4:5 lines were selected from the F_3:4 population and fine‐mapped using insertion/deletion (InDel) markers. qSTV11^z was mapped to a 520‐kb region between the InDel markers Sid2 and Indel8. This region included OsSOT1 (candidate gene for STV11) and other previously reported RSV resistance QTLs. The OsSOT1 sequence in Ilpum and Zenith was identical to that of the susceptible variety ‘Koshihikari’, indicating that OsSOT1 is not the candidate gene of qSTV11^z. The localization of qSTV11^z should provide useful information for marker‐assisted selection and determination of genetic resources in rice breeding.     

Mapping QTLs related to salinity tolerance of rice at the young seedling stage

Using a population of recombinant inbred lines of the 164 genotypes derived from a cross between ‘Milyang 23’ (indica) and ‘Gihobyeo’ (japonica) in rice (Oryza sativa L.), salt tolerance was evaluated at a young seedling stage in concentrations of 0.5% and 0.7% NaCl. Mapping quantitative trait loci (QTLs) related to salt tolerance was carried out by interval mapping using Qgene 3.0. Two QTLs (qST1 and qST3) conferring salt tolerance at young seedling stage were mapped on chromosome 1 and 3, respectively, and explained 35.5–36.9% of the total phenotypic variation in 0.5% and 0.7% NaCl. The favourable allele of qST1 was contributed by ‘Gihobyeo’, and that of qST3 by ‘Milyang 23’. The results obtained in 0.5% and 0.7% NaCl for 2 years were similar in flanked markers and phenotypic variation.     

Comparison and analysis of main effects,epistatic effects,and QTL × environment interactions of QTLs for agronomic traits using DH and RILs populations in rice

Two genetic linkage maps based on doubled haploid (DH) and recombinant inbred lines (RILs) populations, derived from the same indica-japonica cross ‘Samgang × Nagdong’, were constructed to analyze the quantitative trait loci (QTLs) affecting agronomic traits in rice. The segregations of agronomic traits in RILs population showed larger variations than those in DH population. A total of 10 and 12 QTLs were identified on six chromosomes using DH population and seven chromosomes using RILs population, respectively. Three stable QTLs including pl9.1, ph1.1, and gwp11.1 were detected through different years. The percentages of phenotypic variation explained by individual QTLs ranged from 8 to 18% in the DH population and 9 to 33% in the RILs population. Twenty-three epistatic QTLs were identified in the DH population, while 21 epistatic QTLs were detected in the RILs population. Epistatic interactions played an important role in controlling the agronomic traits genetically. Four significant main-effect QTLs were involved in the digenic interactions. Significant interactions between QTLs and environments (QE) were identified in two populations. The QTLs affecting grain weight per panicle (GWP) were more sensitive to the environmental changes. The comparison and QTLs analysis between two populations across different years should help rice breeders to comprehend the genetic mechanisms of quantitative traits and improve breeding programs in marker-assisted selection (MAS).     

A molecular framework for risk assessment of a virus-tolerant transgenic pepper line

The Cucumber mosaic virus coat protein (CMV-CP) gene-transgenic pepper lines exhibit high tolerance to Cucumber mosaic virus (CMV) strains. In this study, E7, one of the CMVP0-CP transgenic chili pepper events selected by screening was further characterized. Southern blotting and inverse PCR analysis revealed that the E7 event contains a single copy of the inserted gene cassette whose flanking sequences appear to be noncoding and intergenic. We searched for pepper-specific DNA sequence candidates as an endogenous reference gene for GM-pepper detection. We found that only one copy of CaSIG4 and lipocalin genes are present in the pepper genome and their sequences were determined to be pepper-specific. The characterization of the genomic sequences flanking the transgene, as well as the availability of the pepper-specific single copy CaSIG4 and lipocalin genes as endogenous reference genes, enabled the design of E7-event-specific PCR-based quantitative detection methods. The CMV-CP protein levels in the CMV-inoculated wild-type pepper tissues were approximately 60 times higher than those in the uninoculated and CMV-inoculated E7 pepper tissues. These results suggested that the amount of CMV-CP expressed in transgenic pepper tissue was negligible relative to the amount of CMV-CP in the virus-infected wild-type pepper consumed by human beings. This work may prove useful for risk assessment studies of transgenic pepper lines. Furthermore, the characterized single copy genes, lipocalin and CaSIG4, may be used to develop a method to detect gene copy number variations in the pepper genome.     

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. This revised version was published online in August 2006 with corrections to the Cover Date.     

Combining ability of seed vigor and seed yield in soybean

Studies have shown no consensus in relationships between seed yield and vigor in soybean [Glycine max (L.) Merrill]. The lack of information regarding the inheritance of seed vigor prompted this study to determine the types of gene action and combining ability estimates for seed vigor and its related traits. Five high and six low seed vigor soybean genotypes were crossed in a diallel, and selfed to produce 55 F₂ progenies, which were examined, along with the parents, for seed vigor, yield, and seed weight. Significant genotype and environment effects were found for seed vigor and yield. General combining ability (GCA) effects for seed vigor and seed yield were significant (p≤ 0.01) and larger than specific combining ability (SCA) effects. Significant GCA and SCA effects were found for seed weight, indicating that both additive and non additive genetic effects were involved in conditioning seed weight. The ratios of mean square, 2GCA / (2GCA+SCA), were 0.96 for seed vigor and 0.93 for seed yield. These ratios indicated that additive gene effects were more important than non additive gene effects for seed vigor and seed yield in these crosses. Mean seed vigor(83.8%), as determined by accelerated aging germination, and mean seed yield (2,155 kg ha^-1)in high vigor × high vigor crosses were higher than the high vigor × low vigor and low vigor × low vigor crosses. Mean percent accelerated aging germination rates in F₂ populations from diallel crosses were significantly related to mid-parent seed vigor(r² = 0.52^**) and midparent seed size (r² = 0.31^**). These results indicated that levels of seed vigor can be improved through breeding, while maintaining high yields because of the predominance of GCA effects in both seed vigor and seed yield. This revised version was published online in July 2006 with corrections to the Cover Date.     

Including root architecture in a crop model improves predictions of spring wheat grain yield and above‐ground biomass under water limitations

Although the root length density (RLD) of crops depends on their root system architecture (RSA), the root growth modules of many 1D field crop models often ignored the RSA in the simulation of the RLD. In this study, two model set‐up scenarios were used to simulate the RLD, above‐ground biomass (AGB) and grain yield (GY) of water‐stressed spring wheat in Germany, aiming to investigate the impact of improved RLD on AGB and GY predictions. In scenario 1, SlimRoot, a root growth sub‐model that does not consider the RSA of the crop, was coupled to a Lintul5‐SlimNitrogen‐SoilCN‐Hillflow1D crop model combination. In scenario 2, SlimRoot was replaced with the Somma sub‐model which considered the RSA for simulating RLD. The simulated RLD, AGB and GY were compared with observations. Scenario 2 predicted the RLD, AGB and GY with an average root mean square error (RMSE) of 0.43 cm/cm³, 0.59 t/ha and 1.03 t/ha, respectively, against 1.03 cm/cm³, 1.20 t/ha and 2.64 t/ha for scenario 1. The lower RMSE under scenario 2 shows that, even under water‐stress conditions, predictions of GY and AGB can be improved by considering the RSA of the crop for simulating the RLD.     

The inheritance of the red colour character in European pear (Pyrus communis) and its map position in the mutated cultivar ‘Max Red Bartlett’

The inheritance of the red colour character in European pear (Pyrus communis L.) was studied over 3 years in seven progeny obtained by using the cultivars ‘Max Red Bartlett’, ‘Cascade’ and ‘California’ as red‐skinned fruit parental lines. One of these progeny (derived from the cross ‘Abbé Fétel’ × ‘Max Red Bartlett’, a red mutation of ‘Bartlett’) was already used to construct two linkage maps and, being ‘red colour’ a monogenic dominant trait, it was possible to locate it as morphological marker in the linkage group 4 of ‘Max Red Bartlett’. For the first time, this trait has been mapped out of linkage group 9 in a species belonging to the Maloideae subfamily moreover in a mutated sport. An improved knowledge of the genetic basis of production and accumulation of red pigments in the fruit skin will better support the pear breeding programmes aimed to select new cultivars carrying this appealing trait.