In vitro selection and characterization of putative probiotics isolated from the gut of Acipenser baerii (Brandt, 1869)

To select and characterize potential probiotic bacteria from the gut microbiota of Siberian sturgeon (Acipenser baerii), 129 strains isolated from the hindgut were screened for antagonistic activity against five fish pathogens. Ten isolates showed antagonism towards three or more pathogens. Nine of these isolates were Gram‐positive, belonging to Lactococcus (seven) and Bacillus (two), and a single strain belonging to the Gram‐negative Citrobacter. These inhibitory isolates were identified using genetic, phentotypic and biochemical traits, and further characterized by in vitro tests assessing the adhesion and growth in mucus and resistance to gastric and intestinal fluids. The candidate probiotics were determined to be non‐pathogenic through an in vivo study. Based on these assays, Lactococcus lactis ssp. lactis STG45 and STG81 showed the broadest inhibitory potential, a high viability in simulated gastrointestinal juice and the highest adhesion capacity to mucus. They were therefore selected as the most promising candidate probiotics. This is the first study screening probiotics among the gut microflora of Siberian sturgeon.     

Plasma kinetics and efficacy of oral megazol treatment in Trypanosoma brucei brucei-infected sheep

Experimentally infected sheep have been previously developed as an animal model of trypanosomosis. We used this model to test the efficacy of megazol on eleven Trypanosoma brucei brucei-infected sheep. When parasites were found in blood on day 11 post-infection, megazol was orally administered at a single dose of 40 or 80mg/kg. After a transient aparasitaemic period, all animals except two relapsed starting at day 2 post-treatment, which were considerated as cured on day 150 post-treatment and showed no relapse after a follow-up period of 270 days. In order to understand the high failure of megazol treatment to cure animals, a kinetic study was carried out. Plasma concentrations of megazol determined, by reverse-phase high-performance liquid chromatography at 8h post-treatment in these animals, were lowered, suggesting slow megazol absorption, except in cured animals. However, megazol plasma profiles in uninfected sheep after a single oral dose of megazol showed a fast megazol lowered absorption associated with a short plasma half-life of drug. Inter-individual variation of megazol pharmacokinetic properties was also observed. These findings suggested that the high failure rates of megazol treatment were related to poor drug availability after oral administration in sheep. In conclusion, megazol could cure sheep with T. b. brucei infection but oral administration was not an effective route.     

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.