Plasma kinetics and efficacy of oral megazol treatment in Trypanosoma brucei brucei-infected sheep

Experimentally infected sheep have been previously developed as an animal model of trypanosomosis. We used this model to test the efficacy of megazol on eleven Trypanosoma brucei brucei-infected sheep. When parasites were found in blood on day 11 post-infection, megazol was orally administered at a single dose of 40 or 80mg/kg. After a transient aparasitaemic period, all animals except two relapsed starting at day 2 post-treatment, which were considerated as cured on day 150 post-treatment and showed no relapse after a follow-up period of 270 days. In order to understand the high failure of megazol treatment to cure animals, a kinetic study was carried out. Plasma concentrations of megazol determined, by reverse-phase high-performance liquid chromatography at 8h post-treatment in these animals, were lowered, suggesting slow megazol absorption, except in cured animals. However, megazol plasma profiles in uninfected sheep after a single oral dose of megazol showed a fast megazol lowered absorption associated with a short plasma half-life of drug. Inter-individual variation of megazol pharmacokinetic properties was also observed. These findings suggested that the high failure rates of megazol treatment were related to poor drug availability after oral administration in sheep. In conclusion, megazol could cure sheep with T. b. brucei infection but oral administration was not an effective route.     

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.     

Evaluation of ground reaction forces produced by chickens walking on a force plate

OBJECTIVE: To evaluate the use of a force plate as a method for objective gait analysis in adult poultry, to characterize ground reaction forces (GRFs) produced in adult chickens during normal walking, and to assess the variability of GRFs. ANIMALS: 18 clinically normal 5-month-old Brown Leghorn hens. PROCEDURE: Vertical, craniocaudal, and mediolateral GRFs were measured as hens walked across a standard force plate embedded in the middle of a runway. RESULTS: All GRFs were significantly affected by speed, and variability was high. With increasing speed, overall stance time decreased, but the percentage of stance time spent in braking or propulsion remained approximately equal. There was an overall increase in maximum propulsion force, which was produced at a greater rate over a shorter time; thus, propulsion integral decreased. Maximum braking forces and braking integrals were variable, but the rate at which the forces were generated increased. Mediolateral forces were 2 to 3 times greater in hens than values that have been reported for other species. CONCLUSIONS AND CLINICAL RELEVANCE: A standard force plate can be used to objectively measure GRFs in walking adult hens; however, the large variation in the data suggests that the technique in its current form would be of limited clinical use. Overall, vertical and craniocaudal forces had similar characteristics to those of other species, whereas mediolateral forces were found to be much greater in chickens than for other species.     

Effects of preoperative administration of ketoprofen on anesthetic requirements and signs of postoperative pain in dogs undergoing elective ovariohysterectomy

OBJECTIVE: To determine the effects of preoperative administration of ketoprofen on anesthetic requirements and signs of postoperative pain in dogs undergoing elective ovariohysterectomy. DESIGN: Randomized, controlled clinical trial. ANIMALS: 22 clinically normal client-owned dogs. PROCEDURE: 60 minutes before induction of anesthesia, 11 dogs were given ketoprofen (2 mg/kg [0.9 mg/lb], i.m.), and the other 11 were given saline (0.9% NaCl) solution. Dogs were premedicated with glycopyrrolate, acepromazine, and butorphanol and anesthetized with thiopental; anesthesia was maintained with isoflurane. Ovariohysterectomy was performed by an experienced surgeon, and butorphanol was given 15 minutes before completion of the procedure. Objective behavioral scores and numerical pain scores at rest and with movement were recorded every 2 hours for 12 hours after surgery and then every 4 hours for an additional 12 hours. RESULTS: Preoperative administration of ketoprofen did not reduce the dose of thiopental required to induce anesthesia or the end-tidal concentration of isoflurane required to maintain anesthesia. Activity levels and median objective behavioral scores were significantly higher 4 and 6 hours after surgery in dogs given ketoprofen than in dogs given saline solution. However, mean numerical pain scores in dogs given ketoprofen were not significantly different from scores for dogs given saline solution at any time. CONCLUSIONS AND CLINICAL RELEVANCE: Results suggest that preoperative administration of ketoprofen does not reduce anesthetic requirements in dogs undergoing elective ovariohysterectomy but may reduce signs of pain after surgery. Results also suggest that the objective behavioral score may be a more sensitive measure of acute postoperative pain than traditional numerical pain scores.     

ULTRASONOGRAPHY AS A DIAGNOSTIC TOOL IN SHARK SPECIES

The use of sonography was evaluated in eleven sharks as a potential diagnostic and investigative tool. Individual sharks were anesthetized with MS-222 (Tricane Methane Sulphonate) and sonograms recorded from various planes using a 3 MHZ linear array scanner. Sonographic images were compared with corresponding postmortem cross sections. Heart rate and rhythm were monitored with real time sonography in an attempt to gauge the depth of the anesthesia. Heart rates ranged from 12–46 bpm. Initial results of this study suggest that sonography may be a useful technique in shark species where the application of radiographic techniques is limited by the lack of adipose tissue and the need to maintain the animal in water.     

Assistive devices, orthotics, and prosthetics.

Deciding on which supportive device, orthotic, or prosthetic is best suited for a given patient is a complex process involving many different factors. The ability to manage biomechanical abnormalities successfully may be enhanced by an understanding of the properties of the various materials that comprise these devices, their effect on functional performance, and other associated patient factors. Veterinary health care providers are faced with the challenge of effectively addressing the physiologic and fiscal needs of the patient in a rapidly changing patient care environment.     

Logistics of companion animal rehabilitation.

Setting up rehabilitation services presents several challenges to the veterinary practitioner. Members of the rehabilitation team need to have a solid knowledge base of acute and chronic orthopedic and neurologic disorders and a knowledge of rehabilitation principles and applications.The working environment has to be adapted to patients with limited mobility, specific equipment and supplies are to be used, and a fee structure should be implemented. This article reviews these logistic aspects of companion animal rehabilitation.