Compression wood induced by 1-N-Naphthylphthalamic acid (NPA), an IAA transport inhibitor

Summary NPA, applied in a 2–3 cm band around the middle protion of 2- or 3-year-old internodes of three vertically-oriented six-year-old Sugi trees (Cryptomeria japonica D. Don), brought about abnormal thickening all over the upper segment from the NPA treatment. Xylem tissues above and below the treatment, as well as at the treated area itself, was examined by ordinary light microscopy and by scanning electron microscopy. The results obtained seemed to indicate that the tissue formed after treatment in the upper segment of the stem was true compression wood. In the lower segment of the stem, no abnormal tissue but a small amount of latewood-like tissue was produced after treatment.Referring to the previous studies in which morphactin, another IAA transport inhibitor, has induced compression wood, we consider it likely that compression wood formation must be induced by high concentrations of endogenous IAA, which could be brought about by blockage created not only by NPA and morphactins, but also by IAA transport inhibitors in general.     

Stocking effectiveness of hatchery-released kuruma prawns estimated by two-stage sampling of commercial catch in Ariake Sound, Japan

ABSTRACT:    To evaluate the stocking effectiveness of the kuruma prawn Penaeus japonicus , a two-stage sampling survey of Gensiki bottom-drift-netters was carried out in Ariake Sound, Saga Prefecture, Japan. A total of 471 000 hatchery-produced juveniles, marked by cutting off the right uropods, was released. Thirty-three fishing days were randomly drawn from four boats, which were selected from the 80 boats operating in the fishery. All prawns caught on the selected days were examined, and the hatchery-produced individuals were identified by their regenerated uropods. A telephone survey of all boats was also conducted, to determine the number of fishing days. A total of 286 marked prawns were caught on the survey days for the Saga area in Ariake Sound, from the last half of July to the first half of September 2002. The recapture rate and standard error were estimated at 0.76 ± 0.52%. Economic efficiency was estimated at 0.28 ± 0.02. Strategies for sampling schemes and stock recovery are also discussed.     

Mottled coloration of haploid-diploid and diploid-triploid mosaic amago salmon Oncorhynchus masou ishikawae

ABSTRACT:   Mottled amago salmon Oncorhynchus masou ishikawe with both yellow- and dark-pigmented skin occurred together with typical albino individuals in a commercial farm. Out of 12 mottled fish examined by DNA content flow-cytometry and erythrocytic nucleus size, three were diploid, eight were haploid-diploid mosaic and one was diploid-triploid mosaic. This fact indicates that the mottled coloration might link to polyploid mosaicism. Genotype of diploid and non-diploid cells at the albino locus was estimated in nine mature mottled fish by observing the frequency of wild-type and albino progeny when mating to homozygous albino ( aa ). One diploid and three haploid-diploid mosaic mottled fish were presumed to have mosaic genotype with both hemizygous ' a ' and heterozygous ' Aa ' cells ( a/Aa ), because the segregation ratio between two phenotypes was 1 : 1. Three other haploid-diploid mosaic fish were presumed to have mosaic genotype with both hemizygous ' a ' and homozygous ' AA ' cells ( a/AA ), because of exclusive occurrence of wild-type phenotype in the progeny. The diploid-triploid mosaic mottled fish was presumed to have mosaic genotypes ' aa / AAA ', ' aa/AAa ' or ' aa / Aaa ', because this fish yielded only albino progeny. One diploid mottled fish produced both two phenotypes but albino embryos appeared with much more frequency than the expectation, when assuming the genotype ' Aa '. Thus, this fish was considered to have mosaic genotype ' Aa/aa '.     

Highly metastatic ovarian yolk sac carcinoma in a rat

We investigated a highly metastatic ovarian yolk sac carcinoma in a 52-week-old female Crl:CD(SD) rat. Macroscopically, the present case had severe ascites, bilateral ovarian masses and numerous nodules in the abdominal and thoracic cavities. Histopathologically, these masses and nodules were generally composed of two types of cells mimicking a parietal and visceral yolk sac. The parietal cells were round to polygonal, contained eosinophilic droplets and were arranged in nests and cords in the eosinophilic matrix. Both the intracytoplasmic droplets and the matrix were stained positively with PAS. The visceral cells were cylindriform, and proliferated in papillary and tubular patterns and occasionally formed Shiller-Duval body-like structures. In the dissemination sites, the neoplastic cells proliferated on the surface of the various tissues and often infiltrated into deeper parts of the tissues. Immunohistochemically, both neoplastic cells were positive for α-fetoprotein and keratin, and the eosinophilic matrix was positive for laminin. Ultrastructurally, the parietal cells had dilated rough endoplasmic reticulums, which were filled with electron-lucent laminated structures. The visceral cells had poorly to moderately developed intracytoplasmic organelles and were interconnected with desmosomes. Taken together, the present tumor was diagnosed as yolk sac carcinoma arising from the ovary and was characterized by not only high metastasis but also invasive infiltration with biphasic proliferation of the parietal and visceral cells.     

The genetic diversities of 4 species of subg. Lithocerasus (Prunus, Rosaceae) revealed by RAPD analysis

RAPD analysis was applied to reveal the genetic diversities of 4 speciesof subg. Lithocerasus within the genus Prunus using 40accessions representing the subgenera Prunophora, Amygdalus,Lithocerasus and Cerasus. The accession of subg. Lithocerasus are phenotypically similar to members of subgenus Cerasus but different with them in interspecific crossing tests and isozymeprofiles. Two major clusters, `Prunophora and Amygdalus group' and `Cerasus group' were constructed in the phenogram. We revealthat the examined 4 species of subg. Lithocerasus species; P.tomentosa Thunb., P. japonica Thunb., P. glandulosa Thunb.and P. besseyi Bailey, were genetically closer to the members ofsubgenera Prunophora and Amygdalus than to subg. Cerasus.     

RAPD markers for discriminating tea germplasms at the inter-specific level in China

For the discrimination of tea germplasms at the inter‐specific level, four tea species and varieties (Camellia sinensis, C. sinensis var. assamica, C. sinensis var. pubilimba, C. sinensis var. kucha) and their 20 wild allied species (C. sp.) preserved in the China National Germplasm Tea Repositories (CNGTR) were investigated using randomly amplified polymorphic DNA (RAPD) markers. Fifteen primers were chosen from the 61 screened for RAPD amplification. The average DNA polymorphic frequency of RAPD primers at the inter‐specific level was 0.30, varying from 0.16 to 0.60, lower than that at the intra‐specific level. Using the presence, sometimes absence of unique RAPD markers, it was possible to discriminate 14 of the germplasms investigated. No single primer could discriminate all the 24 germplasms. However, OPO‐13 provided rich band patterns and it could discriminate 10 genotypes. The combination of two and three primers made it possible to discriminate 15 and 21 germplasms, respectively. Furthermore, the combination of band patterns or the DNA fingerprinting based on specific RAPD markers generated by OPO‐13, OPO‐18, OPG‐12 and OPA‐13 allowed the discrimination of all 24 germplasms investigated. Therefore, RAPD markers also provide a powerful tool to differentiate tea germplasms at the inter‐specific level.     

Effects of tyrosine administration on serum biopterin in normal controls and patients with Parkinson's disease

After administration of tyrosine, total concentration of biopterin, the cofactor for tyrosine hydroxylase, was increased in the striatum, adrenal glands, and serum of rats, and in the serum of humans. Serum biopterin is lower in patients with Parkinson's disease than in normal controls. After oral administration of tyrosine, the increase in serum biopterin concentration was smaller in patients with Parkinson's disease (less than twofold) than in healthy controls (three-to sevenfold). These results suggest that tyrosine may have a regulatory role in biopterin biosynthesis and that patients with Parkinson's disease may have some abnormality in the regulation of biopterin biosynthesis.     

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.