Highly metastatic ovarian yolk sac carcinoma in a rat

We investigated a highly metastatic ovarian yolk sac carcinoma in a 52-week-old female Crl:CD(SD) rat. Macroscopically, the present case had severe ascites, bilateral ovarian masses and numerous nodules in the abdominal and thoracic cavities. Histopathologically, these masses and nodules were generally composed of two types of cells mimicking a parietal and visceral yolk sac. The parietal cells were round to polygonal, contained eosinophilic droplets and were arranged in nests and cords in the eosinophilic matrix. Both the intracytoplasmic droplets and the matrix were stained positively with PAS. The visceral cells were cylindriform, and proliferated in papillary and tubular patterns and occasionally formed Shiller-Duval body-like structures. In the dissemination sites, the neoplastic cells proliferated on the surface of the various tissues and often infiltrated into deeper parts of the tissues. Immunohistochemically, both neoplastic cells were positive for α-fetoprotein and keratin, and the eosinophilic matrix was positive for laminin. Ultrastructurally, the parietal cells had dilated rough endoplasmic reticulums, which were filled with electron-lucent laminated structures. The visceral cells had poorly to moderately developed intracytoplasmic organelles and were interconnected with desmosomes. Taken together, the present tumor was diagnosed as yolk sac carcinoma arising from the ovary and was characterized by not only high metastasis but also invasive infiltration with biphasic proliferation of the parietal and visceral cells.     

The genetic diversities of 4 species of subg. Lithocerasus (Prunus, Rosaceae) revealed by RAPD analysis

RAPD analysis was applied to reveal the genetic diversities of 4 speciesof subg. Lithocerasus within the genus Prunus using 40accessions representing the subgenera Prunophora, Amygdalus,Lithocerasus and Cerasus. The accession of subg. Lithocerasus are phenotypically similar to members of subgenus Cerasus but different with them in interspecific crossing tests and isozymeprofiles. Two major clusters, `Prunophora and Amygdalus group' and `Cerasus group' were constructed in the phenogram. We revealthat the examined 4 species of subg. Lithocerasus species; P.tomentosa Thunb., P. japonica Thunb., P. glandulosa Thunb.and P. besseyi Bailey, were genetically closer to the members ofsubgenera Prunophora and Amygdalus than to subg. Cerasus.     

RAPD markers for discriminating tea germplasms at the inter-specific level in China

For the discrimination of tea germplasms at the inter‐specific level, four tea species and varieties (Camellia sinensis, C. sinensis var. assamica, C. sinensis var. pubilimba, C. sinensis var. kucha) and their 20 wild allied species (C. sp.) preserved in the China National Germplasm Tea Repositories (CNGTR) were investigated using randomly amplified polymorphic DNA (RAPD) markers. Fifteen primers were chosen from the 61 screened for RAPD amplification. The average DNA polymorphic frequency of RAPD primers at the inter‐specific level was 0.30, varying from 0.16 to 0.60, lower than that at the intra‐specific level. Using the presence, sometimes absence of unique RAPD markers, it was possible to discriminate 14 of the germplasms investigated. No single primer could discriminate all the 24 germplasms. However, OPO‐13 provided rich band patterns and it could discriminate 10 genotypes. The combination of two and three primers made it possible to discriminate 15 and 21 germplasms, respectively. Furthermore, the combination of band patterns or the DNA fingerprinting based on specific RAPD markers generated by OPO‐13, OPO‐18, OPG‐12 and OPA‐13 allowed the discrimination of all 24 germplasms investigated. Therefore, RAPD markers also provide a powerful tool to differentiate tea germplasms at the inter‐specific level.     

Effects of tyrosine administration on serum biopterin in normal controls and patients with Parkinson's disease

After administration of tyrosine, total concentration of biopterin, the cofactor for tyrosine hydroxylase, was increased in the striatum, adrenal glands, and serum of rats, and in the serum of humans. Serum biopterin is lower in patients with Parkinson's disease than in normal controls. After oral administration of tyrosine, the increase in serum biopterin concentration was smaller in patients with Parkinson's disease (less than twofold) than in healthy controls (three-to sevenfold). These results suggest that tyrosine may have a regulatory role in biopterin biosynthesis and that patients with Parkinson's disease may have some abnormality in the regulation of biopterin biosynthesis.     

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.     

CTLA-4 control over Foxp3+ regulatory T cell function

Naturally occurring Foxp3+CD4+ regulatory T cells (Tregs) are essential for maintaining immunological self-tolerance and immune homeostasis. Here, we show that a specific deficiency of cytotoxic T lymphocyte antigen 4 (CTLA-4) in Tregs results in spontaneous development of systemic lymphoproliferation, fatal T cell-mediated autoimmune disease, and hyperproduction of immunoglobulin E in mice, and it also produces potent tumor immunity. Treg-specific CTLA-4 deficiency impairs in vivo and in vitro suppressive function of Tregs-in particular, Treg-mediated down-regulation of CD80 and CD86 expression on dendritic cells. Thus, natural Tregs may critically require CTLA-4 to suppress immune responses by affecting the potency of antigen-presenting cells to activate other T cells.     

Control mechanism of the circadian clock for timing of cell division in vivo

Cell division in many mammalian tissues is associated with specific times of day, but just how the circadian clock controls this timing has not been clear. Here, we show in the regenerating liver (of mice) that the circadian clock controls the expression of cell cycle-related genes that in turn modulate the expression of active Cyclin B1-Cdc2 kinase, a key regulator of mitosis. Among these genes, expression of wee1 was directly regulated by the molecular components of the circadian clockwork. In contrast, the circadian clockwork oscillated independently of the cell cycle in single cells. Thus, the intracellular circadian clockwork can control the cell-division cycle directly and unidirectionally in proliferating cells.     

Emission of coherent THz radiation from superconductors

Compact solid-state sources of terahertz (THz) radiation are being sought for sensing, imaging, and spectroscopy applications across the physical and biological sciences. We demonstrate that coherent continuous-wave THz radiation of sizable power can be extracted from intrinsic Josephson junctions in the layered high-temperature superconductor Bi2Sr2CaCu2O8. In analogy to a laser cavity, the excitation of an electromagnetic cavity resonance inside the sample generates a macroscopic coherent state in which a large number of junctions are synchronized to oscillate in phase. The emission power is found to increase as the square of the number of junctions reaching values of 0.5 microwatt at frequencies up to 0.85 THz, and persists up to approximately 50 kelvin. These results should stimulate the development of superconducting compact sources of THz radiation.     

Prediction of Soil Acidification Using a Dymanic Model at a Bamboo Forest in Osaka Prefecture

This study is based on research of throughfall formation and soil chemistry processes. Through the experimental verification of the cation exchange part of the simulation model; making use of results of the flux of acid deposition on the forest and the chemical weathering of soil mineral, we predicted the future soil acidification. The result indicated that chemical weathering occupies the important portion of acid neutralization capacity of the soil and that significant soil acidification will not occur in this field within 40 years, even if the present acid load continues in the future.     

Quality aspect of fish sauce prepared from underutilized fatty Japanese anchovy and rabbit fish

ABSTRACT:   To explore the potential utility of underutilized fish in the fish sauce industry, fish sauces were prepared from both raw and heat-induced meat of Japanese anchovy Engraulis japonica and rabbit fish Siganus fuscescens using wheat malt, and their quality aspects and sensory properties were assessed. Proximate composition of the fish meat represents protein as the major component (16.0–17.8%), other than moisture. Analyses of free amino acids, peptides including oligopeptides, and organic acids contents in fish sauces revealed suitability of both raw and heat-induced meat of the selected species in commercial fish sauce production. The variations in taste of raw meat fish sauces were species-specific, but the taste of fish sauces from heat-induced meat were similar.