Distribution of sulphur fractions in lysimeters previously treated with sulphuric acid,NPK fertilizer and a combination of acid and fertilizer

The retention of applied ³⁵S was studied in a lysimeter experiment, in which the lysimeters, consisting of soil columns with intact field and groundlayer vegetation, had previously been treated with either sulphuric acid, NPK or a combination of sulphuric acid and NPK.³⁵S was applied as Na₂³⁵SO₄ to all lysimeters in an amount corresponding to 2 kg S ha^?1, 3 months before the termination of the experiment. Of the applied ³⁵S, 4.7 ± 1.6% (the error term showing the standard error of the mean) was leached from the lysimeters; ³⁵SO₄^2?, was preferentially sorbed in the upper part of the B horizon, >61% being sorbed in the B horizon as a whole. The influence of previous treatments was seen in SO₄^2? content in the B horizon and also in the SO₄^2? concentrations in the leachates from the lysimeters. Sorption of ³⁵SO₄^2? was enhanced by the acid treatment in the A₀ and A₁/A₂ horizons. Ratios between water-extractable SO₄^2? and KCl-extractable SO₄^2? varied from 0.88 in the A₁/A₂ horizon to 0.46 in the lower part of the B horizon, indicating a preferential sorption of less available SO₄^2? fractions in that part of the soil.Significant positive correlations between soil organic carbon and various sulphur fractions, both labelled and unlabelled, indicated the importance of biological S transformations in the A₀ and A₁/A₂ horizons.Positive correlations between KCl-extractable Al and KCl-extractable SO₄^2? were found in the B horizon. Equilibrium calculations suggested that the SO₄^2? activity and Al³⁺ activity in leachates from control and acidified lysimeters were within the stability fields of basaluminite (Al₄(OH)₁₀SO₄), activities in leachates from the latter group of lysimeters, also being close to jurbanite (Al(OH)SO₄).     

Piscine orthoreovirus (PRV) in red and melanised foci in white muscle of Atlantic salmon (Salmo salar)

Melanised focal changes (black spots) are common findings in the white skeletal muscle of seawater-farmed Atlantic salmon (Salmo salar). Fillets with melanised focal changes are considered as lower quality and cause large economic losses. It has been suggested that red focal changes (red spots) precede the melanised focal changes. In the present work, we examined different populations of captive and wild salmon for the occurrence of both types of changes, which were investigated for the presence of different viruses by immunohistochemistry and RT-qPCR. The occurrence of red or melanised foci varied significantly between the populations, from none in wild fish control group, low prevalence of small foci in fish kept in in-house tanks, to high prevalence of large foci in farm-raised salmon. Large amounts of Piscine orthoreovirus (PRV) antigen were detected in all foci. No other viruses were detected. Red focal changes contained significantly higher levels of PRV RNA than apparently non-affected areas in white muscle of the same individuals. Some changes displayed a transient form between a red and melanised pathotype, indicating a progression from an acute to a chronic manifestation. We conclude that PRV is associated with the focal pathological changes in the white muscle of farmed Atlantic salmon and is a premise for the development of focal melanised changes.     

Scale-dependent importance of environment, land use and landscape structure for species richness and composition of SE Norwegian modern agricultural landscapes

Knowledge of variation in vascular plant species richness and species composition in modern agricultural landscapes is important for appropriate biodiversity management. From species lists for 2201 land-type patches in 16 1-km² plots five data sets differing in sampling-unit size from patch to plot were prepared. Variation in each data set was partitioned into seven sources: patch geometry, patch type, geographic location, plot affiliation, habitat diversity, ecological factors, and land-use intensity. Patch species richness was highly predictable (75% of variance explained) by patch area, within-patch heterogeneity and patch type. Plot species richness was, however, not predictable by any explanatory variable, most likely because all studied landscapes contained all main patch types – ploughed land, woodland, grassland and other open land – and hence had a large core of common species. Patch species composition was explained by variation along major environmental complex gradients but appeared nested to lower degrees in modern than in traditional agricultural landscapes because species-poor parts of the landscape do not contain well-defined subsets of the species pool of species-rich parts. Variation in species composition was scale dependent because the relative importance of specific complex gradients changed with increasing sampling-unit size, and because the amount of randomness in data sets decreased with increasing sampling-unit size. Our results indicate that broad landscape structural changes will have consequences for landscape-scale species richness that are hard or impossible to predict by simple surrogate variables.     

Deeply inverted electron-hole recombination in a luminescent antibody-stilbene complex

The blue-emissive antibody EP2-19G2 that has been elicited against trans-stilbene has unprecedented ability to produce bright luminescence and has been used as a biosensor in various applications. We show that the prolonged luminescence is not stilbene fluorescence. Instead, the emissive species is a charge-transfer excited complex of an anionic stilbene and a cationic, parallel pi-stacked tryptophan. Upon charge recombination, this complex generates exceptionally bright blue light. Complex formation is enabled by a deeply penetrating ligand-binding pocket, which in turn results from a noncanonical interface between the two variable domains of the antibody.     

The mineral content affects vertebral morphology in underyearling smolt of Atlantic salmon (Salmo salar L.)

This study investigated the individual variation in vertebral morphology and mineral content (as % of bone dry weight) in rapid growing underyearling smolt (n = 33) twelve weeks after transfer to seawater. The smolt, which were reared in triplicate tanks, had a large individual variation in vertebral bone mineral content (Tank A: 36.2% min, 45.2% max, 39.6% mean. Tank B: 32.6% min, 46.6% max, 40.0% mean. Tank C: 38.5% min, 47.9% max, 42.4% mean), and were subdivided into two groups based on mean within each tank: high mineral content (HMC, above tank mean, n = 15) and low mineral content (LMC, below tank mean, n = 18). Vertebrae of smolt with a low mineral content were more compressed in the anterior–posterior direction (HMC vertebral length/dorso-ventral diameter ratio 0.83, LMC 0.80). This was related to a change in the growth direction of the vertebral cone. This change occurred around transfer to seawater and was characterised by an increased angle between the wall of the cone of the vertebrae and the cranial–caudal axis, and gave the vertebrae a compressed appearance. Smolt with a high mineral content were significantly longer (HMC 28.1 cm, LMC 26.5 cm) and heavier (HMC 270 g, LMC 210 g) twelve weeks after transfer to seawater.     

Retrospective comparison of azithromycin, clarithromycin, and erythromycin for the treatment of foals with Rhodococcus equi pneumonia

The objective of this retrospective study was to compare the efficacy of azithromycin-rifampin, clarithromycin-rifampin, and erythromycin-rifampin for the treatment of pneumonia caused by Rhodococcus equi in foals. Eighty-one foals with naturally acquired pneumonia caused by R. equi were included in the study. Information on age, sex, breed, physical examination findings, laboratory testing, and thoracic radiography was abstracted from each medical record. Foals were divided in 3 groups based on the antimicrobial agent selected for therapy. Short-term (discharge from the hospital) and long-term (apparently healthy as a yearling) success rates, days of hospitalization, days with fever, days with tachypnea, and percentage of radiographic improvement were compared among groups. Foals treated with clarithromycin-rifampin had significantly (P = .02) higher odds of overall short-term (odds ratio [OR] = 12.2) and long-term (OR = 20.6) treatment success and significantly fewer days with fever than foals treated with erythromycin-rifampin. Foals treated with clarithromycin-rifampin had a significantly (P = .03) higher percentage of radiographic improvement and a tendency (P = .06) toward higher odds of overall short-term (OR = 8.1) and long-term (OR = 11.8) treatment success compared to foals treated with azithromycin-rifampin. Among foals with severe radiographic lesions, the success rates of foals treated with clarithromycin-rifampin both short-term (88%) and long-term (83%) were significantly (P = .02) higher than that of foals treated with azithromycin-rifampin (0%). For each treatment group, the only reported adverse effect was diarrhea that was mild and self-limiting in most cases. The combination clarithromycin-rifampin is superior to azithromycin-rifampin or erythromycin-rifampin for the treatment of pneumonia caused by R. equi in foals in a referral population.     

Escherichia coli Agglutinins in Cow Serum, Colostrum and the Nursing Calf

Immunochemical properties of Escherichia coli O antibodies present in bovine serum and colostrum were investigated. Dam and calf serum samples plus colostral whey samples were fractionated by gel filtration, and the 7S and 19S fractions isolated. Antibody activity against the O antigens of four recognized E. coli bovine pathogens was determined by the indirect hemagglutination test on the whole serum and colostral whey samples and the 7S and 19S fractions thereof. Mercaptoethanol reduction was used to chemically study the immunochemistry of the E. coli O antibodies.

The E. coli O antibodies in dam serum were entirely 19S macroglobulins and appeared to be IgM immunoglobulins. The antibodies in colostrum and calf serum were both 7S and 19S globulins. Reasons for believing these 7S antibodies may be IgG, and the 19S antibodies IgA, immunoglobulins are presented.

     

Morphologische Untersuchungen von Eberspermien unter Verwendung von Testsimplets. Freie Universität Berlin, 1986 (Klinik für Klauentierkrankheiten und Fortpflanzungskunde) 116 S., 90 Tab., 22 Abb., 94 Lit., Zsfg. deutsch und englisch

Schätzung des Körpergewichts von Sauen unter Berücksichtigung von Rasse, Alter, Reproduktionsstadium, Brustumfang, Ernährungszustand und Herkunftsbetrieb. Freie Universität Berlin, 1985 (Tierärztliche Ambulanz Schwarzenbek, Fachbereich Veterinärmedizin) 80 S., 26 Tab., 19 Abb., 110 Lit., Zsfg. deutsch u. englisch
Dreirassenkreuzung beim Schwein—Vergleich zwischen Reinzuchtsauen und Kreuzungssauen in Zuchtleistung, Gesundheitsmerkmalen und Merzungsquote am Lehrund Versuchsgut Oberschleiβheim. Ludwig-Maximilians-Universität München, 1985 (Institut für Tierzucht und Tierhygiene) 111 S., 36 Tab., 6 Abb., 172 Lit., Zsfg. deutsch u. englisch
β-Carotin-Stoffwechsel des Rindes: Verteilung auf die Serumlipoproteine, Transfer in die Milch und in die Follikelflüssigkeit sowie Funktion im Follikel Ludwig-Maximilians-Universität München, 1986 (Institut für Physiologie, Physiologische Chemie und Ernährungsphysiologie) 106 S., 34 Tab., 10 Abb., 100 Lit., Zsfg. deutsch u. englisch
Versuche zur Teilung von Rinderembryonen unter Berücksichtigung verschiedener Entwicklungsstadien Tierärztliche Hochschule Hannover, 1986 (Klinik für Geburtshilfe und Gynäkologie des Rindes) 83 S., 7 Tab., 2 Abb., 110 Lit., Zsfg. deutsch u. englisch
Vorkerndarstellung bei Schweinezygoten Ludwig-Maximilians-Universität München, 1985 (Institut für Tierzucht und Tierhygiene) 86 S., 13 Tab., 3 Abb., 169 Lit., Zsfg. deutsch u. englisch
Abstammung und Rassebildung des Hausschweines Tierärztliche Hochschule Hannover, 1985 (Institut für Zoologie) 176 S., 6 Abb., 237 Lit., Zsfg. deutsch u. englisch     

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.     

Antifungal and peroxidative activities of nonheme chloroperoxidase in relation to transgenic plant protection

Nonheme chloroperoxidase (CPO-P) of Pseudomonas pyrrocinia catalyzes the oxidation of alkyl acids to peracids by hydrogen peroxide. Alkyl peracids possess potent antifungal activity as found with peracetate: 50% killing (LD(50)) of Aspergillus flavus occurred at 25 microM compared to 3.0 mM for the hydrogen peroxide substrate. To evaluate whether CPO-P could protect plants from fungal infection, tobacco was transformed with a gene for CPO-P from P. pyrrocinia and assayed for antifungal activity. Leaf extracts from transformed plants inhibited growth of A. flavus by up to 100%, and levels of inhibition were quantitatively correlated to the amounts of CPO-P activity expressed in leaves. To clarify if the peroxidative activity of CPO-P could be the basis for the increased resistance, the antifungal activity of the purified enzyme was investigated. The LD(50) of hydrogen peroxide combined with CPO-P occurred at 2.0 mM against A. flavus. Because this value was too small to account for the enhanced antifungal activity of transgenic plants, the kinetics of the enzyme reaction was examined and it was found that the concentration of hydrogen peroxide needed for enzyme saturation (K(m) = 5.9 mM) was already lethal. Thus, the peroxidative activity of CPO-P is not the basis for antifungal activity or enhanced resistance in transgenic plants expressing the gene.