Effect of fatty acids added to the milk replacer on white scour and excretion of fatty acids in Holstein calves

In order to examine the relationship between white scour and fatty acids, we added fatty acids to the milk replacer. Twenty healthy Holstein calves were divided into 4 groups, five calves per group; a control group with no fortified fatty acid, and 3 groups fed either with oleic, stearic, or palmitic acid, respectively. The calves were fed milk replacer (5% of the calf's body weight) twice a day but the fatty acids (2 wt % of milk replacer) were added only once. The fecal and blood samples were obtained at 0, 12, 24, 36, and 48 h after feeding of the acids. All five calves in the palmitic acid group, and 3 out of 5 calves each in the stealic and the oleic acid groups had whitish feces after feeding fatty acid. The stearic acid group had a significantly elevated stearic acid concentration in the feces during 24–36 h compared to the pre-feeding level. The fecal concentration of palmitic acid increased significantly at 24–36 h in the palmitic acid group. We concluded that the long-chain saturated fatty acids are one of the causes of white scour in calves.     

Identification of bovine dendritic cell phenotype from bovine peripheral blood

Dendritic cells (DCs) are professional antigen presenting cells, which initiate primary immune responses and also play an important role in the generation of peripheral tolerance. There is no reliable method established for the isolation of bovine peripheral blood DCs, and furthermore, the phenotypes and the functions of bovine DCs are still not fully clear. In the present study, we have attempted to identify bovine peripheral blood DCs by negative-selection. In bovine peripheral blood mononuclear cells (PBMC), we have newly characterized the phenotype of DCs, which is CD11c+/CD172a+. These cells display features of myeloid type DCs. In the thymic medulla, CD11c+/CD172a+ cells were also present and CD1+/CD172a+ cells were additionally detected as a population of DCs. The data suggest that one of the bovine DCs phenotypes from PBMC is derived from myeloid lineages lacking a CD1 molecule, which then drift to several tissues, and that they then may express a CD1 molecule upon their functional differentiation.     

The genetic diversities of 4 species of subg. Lithocerasus (Prunus, Rosaceae) revealed by RAPD analysis

RAPD analysis was applied to reveal the genetic diversities of 4 speciesof subg. Lithocerasus within the genus Prunus using 40accessions representing the subgenera Prunophora, Amygdalus,Lithocerasus and Cerasus. The accession of subg. Lithocerasus are phenotypically similar to members of subgenus Cerasus but different with them in interspecific crossing tests and isozymeprofiles. Two major clusters, `Prunophora and Amygdalus group' and `Cerasus group' were constructed in the phenogram. We revealthat the examined 4 species of subg. Lithocerasus species; P.tomentosa Thunb., P. japonica Thunb., P. glandulosa Thunb.and P. besseyi Bailey, were genetically closer to the members ofsubgenera Prunophora and Amygdalus than to subg. Cerasus.     

RAPD markers for discriminating tea germplasms at the inter-specific level in China

For the discrimination of tea germplasms at the inter‐specific level, four tea species and varieties (Camellia sinensis, C. sinensis var. assamica, C. sinensis var. pubilimba, C. sinensis var. kucha) and their 20 wild allied species (C. sp.) preserved in the China National Germplasm Tea Repositories (CNGTR) were investigated using randomly amplified polymorphic DNA (RAPD) markers. Fifteen primers were chosen from the 61 screened for RAPD amplification. The average DNA polymorphic frequency of RAPD primers at the inter‐specific level was 0.30, varying from 0.16 to 0.60, lower than that at the intra‐specific level. Using the presence, sometimes absence of unique RAPD markers, it was possible to discriminate 14 of the germplasms investigated. No single primer could discriminate all the 24 germplasms. However, OPO‐13 provided rich band patterns and it could discriminate 10 genotypes. The combination of two and three primers made it possible to discriminate 15 and 21 germplasms, respectively. Furthermore, the combination of band patterns or the DNA fingerprinting based on specific RAPD markers generated by OPO‐13, OPO‐18, OPG‐12 and OPA‐13 allowed the discrimination of all 24 germplasms investigated. Therefore, RAPD markers also provide a powerful tool to differentiate tea germplasms at the inter‐specific level.     

New types of major anthocyanins detected in Japanese garden iris and its wild forms

The anthocyanins of 130 cultivars, 13 lines and 3 wild forms of Iris ensata were analyzed by HPLC, and these plants were classified into 16 types of major anthocyanins. Among these types, 8 types such as petunidin 3RGac5G – delphinidin 3RGac5G, delphinidin 3RGac5G – petunidin 3RGac5G, cyanidin 3RGac5G – peonidin 3RGac5G, delphinidin 3RG – delphinidin 3RGac, petunidin 3RG5G – malvidin 3RG5G, malvidin 3RG5G – peonidin 3RG5G, peonidin 3RG5G – cyanidin 3RG5G and peonidin 3RG – cyanidin 3RG were obtained as new types. In these new types, peonidin 3RG – cyanidin 3RG and peonidin 3RG5G – cyanidin 3RG5G types were noteworthy because cyanidin 3RG and cyanidin 3RG5G are useful for the breeding of red flowers in I. ensata. This revised version was published online in July 2006 with corrections to the Cover Date.     

Microbial biomass and activity in urban soils contaminated with Zn and Pb

Summary The effects of heavy metals on microbial biomass and activity were investigated in 30 urban soils, contaminated mainly with Zn and Pb to different extents, in terms of the physicochemical and biological characteristics of the soils. Evaluated by simple and multiple regression analyses, the microbial biomass was not affected significantly by easily soluble Zn + Pb (extractable with 0.1 NHCI). The biomass was accounted for as a function of cation exchange capacity (CEC), total organic C and the numbers of fungal colonies present (R ² = 0.692). Carbon dioxide evolution from soils, which reflected microbial activity, was studied on soils incubated with microbial-promoting substrates (glucose and ammonium sulfate) or without. Carbon dioxide evolution was negatively related to Zn+Pb, and this inhibitory effect of the metals was greater in the soils incubated with substrates. Carbon dioxide evolution in soils with substrates was closely related to Zn+Pb, bacterial numbers and the numbers of fungal colonies (R ² = 0.718). Carbon dioxide evolution in soils without substrates was accounted for as a function of Zn + Pb, biomass and the C/N ratio (R ² = 0.511). Using these relationships, the effects of heavy metals on soil microorganisms are discussed in terms of metabolically activated and dormant populations.     

The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants

We report the draft genome sequence of the model moss Physcomitrella patens and compare its features with those of flowering plants, from which it is separated by more than 400 million years, and unicellular aquatic algae. This comparison reveals genomic changes concomitant with the evolutionary movement to land, including a general increase in gene family complexity; loss of genes associated with aquatic environments (e.g., flagellar arms); acquisition of genes for tolerating terrestrial stresses (e.g., variation in temperature and water availability); and the development of the auxin and abscisic acid signaling pathways for coordinating multicellular growth and dehydration response. The Physcomitrella genome provides a resource for phylogenetic inferences about gene function and for experimental analysis of plant processes through this plant's unique facility for reverse genetics.     

Effects of tyrosine administration on serum biopterin in normal controls and patients with Parkinson's disease

After administration of tyrosine, total concentration of biopterin, the cofactor for tyrosine hydroxylase, was increased in the striatum, adrenal glands, and serum of rats, and in the serum of humans. Serum biopterin is lower in patients with Parkinson's disease than in normal controls. After oral administration of tyrosine, the increase in serum biopterin concentration was smaller in patients with Parkinson's disease (less than twofold) than in healthy controls (three-to sevenfold). These results suggest that tyrosine may have a regulatory role in biopterin biosynthesis and that patients with Parkinson's disease may have some abnormality in the regulation of biopterin biosynthesis.     

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.