Possibility of genetic improvement of pigeonpea (Cajanus cajan (L.)Millsp.) utilizing wild gene sources

Summary Various wild relatives of pigeonpea,Cajanus cajan, namely some species ofAtylosia andRhynchosia, possess desirable characteristics that could be utilized for effecting genetic improvement of this crop. In total 73 cross combinations among two cultivars ofC. cajan and one accession each of eightAtylosia species and one ofRhynchosia were attempted. Twelve hybrids were obtained. Seven of these were analysed for F₁ fertility and their utility for agronomic improvement of theC. cajan. Fertility behaviour of the different F₁ hybrids varied and indicated that potential of gene transfer between the two genera,Atylosia andCajanus, was as good as within the genusAtylosia. From F₂ and F₃ families ofC. cajan × A. scarabaeoides andC. cajan × A. albicans, plants were selected with greater physiological efficiency and agronomic superiority. The prospects of transferring pod borer resistance and higher seed protein content from someAtylosia species to pigeonpea are discussed.     

Diversity in selected wild and cultivated species of pigeonpea using RFLP of mtDNA

Diversity in 28 accessions representing 12 species of the genus, Cajanus arranged in 6 sections including 5 accessions of the cultivated species, C. cajan, and 4 species of the genus Rhyncosia available in the germplasm collection at ICRISAT was assessed using RFLP with maize mtDNA probes. Cluster analysis of the Southern blot hybridization data with 3 restriction enzymes – 3 probe combinations placed the genus Rhyncosia in a major group well separated from all the species belonging to the genus Cajanus. Within the genus Cajanus, the 4 accessions of C. platycarpus belonging to section Rhynchosoides formed a separate group in contrast to those in other sections of pigeonpea. In the section, Cajanus all the 5 accessions of C. cajan were grouped together and C. cajanifolius belonging to the same section was in a subgroup by itself closer to the main group. The four accessions of C. scarabaeoides, were together and the other species belonging to section Cantharospermum were in different subgroups. The intra-specific variation was seen even within accessions of certain pigeonpea wild species such as C. scarabaeoides, C. platycarpus, C. acutifolius, and even the cultivated species of C. cajan. This study suggests that RFLP of mtDNA can be used for the diversity analysis of pigeonpea and it gives some indications on the maternal lineage among the species. The variations in the mitochondrial DNA hybridization patterns also suggest the extensive rearrangement of the organelle genome among the Cajanus species. This revised version was published online in July 2006 with corrections to the Cover Date.     

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. This revised version was published online in August 2006 with corrections to the Cover Date.     

Analysis of the molecular basis of Pseudomonas syringae pv. tomato resistance in tomato

Tomato (Lycopersicon esculentum) cultivars that contain the Pto bacterial resistance locus also exhibit sensitivity to fenthion, an organophosphorous insecticide. Resistance to Pseudomonas syringae pv. tomato (Pst) encoded by the Pto gene and sensitivity to fenthion cosegregate in large F₂ populations and were apparently introgressed together into tomato from the wild species Lycopersion pimpinellifolium. In order to isolate the genes responsible for these two phenotypes and to study their molecular basis, a multistep map-based cloning project was initiated. A closely linked RFLP marker was used to isolate a yeast artificial chromosome (YAC) clone that spanned the Pto region. Transcribed sequences within the Pto region were identified by isolating cDNA clones that hybridized to the YAC clone. Transformation of candidate cDNA clones into a Pst-susceptible, fenthion-insensitive tomato line succeeded in identifying a cDNA conferring Pst resistance and a separate cDNA conferring sensitivity to fenthion. The cDNA clones represent members of a tandemly repeated gene family and encode putative serine-threonine protein kinases. The role of these kinases in recognizing a signal from Pst or the fenthion molecule and in activating the plant response is currently being investigated.Abbreviations Pst Pseudomonas syringae pv. tomato - RAPD random amplified fragment polymorphism - RFLP restriction fragment length polymorphism - YAC yeast artifical chromosome     

Seed protein profiles of pigeon pea (Cajanus cajan) and some Atylosia species

Summary The seed protein profile of pigeon pea (Cajanus cajan) appeared to be highly stable. The standard profile of this cultigen was found in 86 of the 90 accessions examined. Each of the Atylosia species, A. lineata, A. platycarpa, A. cajanifolia and A. scarabaeoides has its own profile but each band of the Atylosia species had a homologue in the standard profile of Cajanus or in one of its variants. This was taken as an indication for the polyphyletic origin of Cajanus from several Atylosia species. The appearance of specific Atylosia bands in some of the electrophoretic variants of Cajanus suggests that gene flow is still effective between pigeon pea and various Atylosia species. The poor solubility of the Atylosia seed protein in comparison to Cajanus indicates that domestication of Cajanus was coupled with increased solubility and perhaps a better nutritional value of this pulse as well.     

Cytoplasmic genetic diversity in bananas and plantains

Summary Concerns over yield declines in bananas and plantains due to the spread of Black Sigatoka disease in Musa have drawn attention to the collection of Musa germplasm and its use in conventional and biotechnological improvement programs. This report demonstrates the use of chloroplast DNA (cpDNA) restriction fragment length polymorphisms (RFLPs) for differentiating cytoplasms of various Musa clones. DNA was extracted from lyophilized leaf blade tissue and digested with either Eco R1, Hind III, Bam H1 or Pst I. Southern blots onto nylon membranes were probed with radioactively labeled heterologous orchid and lettuce cpDNA fragments. Among the 14 Musa clones examined, a single balbisiana and four acuminata-type cytoplasms were differentiated. The ability to distinguish between cytoplasms and to place plants within a cytoplasmic grouping demonstrates the usefulness of RFLP technology in evaluating diversity and determining the ancestry of Musa clones.     

PCR-RFLP analysis of the whole chloroplast DNA from three cultivated species of cotton (Gossypium L.)

Variations of the chloroplast DNA (cpDNA) from three of the four cultivated species of cotton (Malvaceae); Gossypium barbadense L., Gossypium hirsutum L., Gossypium arboreum L. and its synonym Gossypium nanking Meyen., were analyzed. Using specific set of primers, the whole circular cpDNAs from the four test species were amplified. These were subsequently digested with the use of seven restriction enzymes. The amplified fragments of the whole cpDNAs of the diploid cultivated cotton G. arboreum and its synonym G. nanking did not show any differences. However, the allotetraploid cultivated cottons G. barbadense and G. hirsutum, showed some fragment length differences directly visible after amplification and two types of restriction fragment length polymorphism (RFLP), the first appeared as slightly lengthened bands and the other as gain or loss of a restriction site. The results also showed that the chloroplast genomes of the allotetraploid cultivated cottons are highly similar to the diploid cultivated cottons tested in terms of length and digestion patterns. The detected amplified length differences, RFLPs and the restriction sites can be considered as species specific markers for the allotetraploid cultivated cottons, which could be a useful tool for future studies of the cpDNA of the genus Gossypium L.     

Chloroplast DNA variation in the wild potato species, Solanum acaule and S. albicans

The chloroplast DNA of Solanum acaule (109 accessions) and S. albicans (9 accessions) was investigated by restriction endonuclease analysis. Unexpectedly, all the accessions analyzed had C type chloroplast DNA in common. This suggested that S. acaule originated from a species with C type chloroplast DNA. DraI restriction digestion revealed further differentiation of C type chloroplast DNA into 8 types. The DraI polymorphism indicated the province of Salta in Argentina and the nearby regions to be a center of diversity for S. acaule. Surprisingly, S. albicans as well as S. acaule both ssp. acaule and ssp. punae, from Peru were virtually indistinguishable, although by morphology and/or cytology all three taxa are easily distinguished. This revised version was published online in July 2006 with corrections to the Cover Date.     

Targeted BSA mapping of Scmv1 and Scmv2 conferring resistance to SCMV using PstI/MseI compared with EcoRI/MseI AFLP markers

In a previous study, two chromosome regions (Scmv1 and Scmv2), conferring sugarcane mosaic virus (SCMV) resistance in maize, were enriched with EcoRI/MseI AFLP (Eco‐AFLP) markers (methylation insensitive) by targeted bulked segregant analysis (tBSA). The objective of the present study was to further saturate these two regions with PstI/MseI AFLP (Pst‐AFLP) markers (methylation sensitive) using the same tBSA approach, and to compare the genomic distribution of both Pst‐AFLP and Eco‐AFLP markers. Out of 470 PstI/MseI primer combinations screened, four Pst‐AFLP markers were identified in the Scmv1 region (chromosome 6), and none in the Scmv2 region (chromosome 3). These Pst‐AFLP markers were more closely linked to the Scmv1a gene than any of the Eco‐AFLP markers, and could be useful for marker‐assisted selection and even map‐based cloning. In addition, Pst‐AFLP and Eco‐AFLP markers were dissimilarly distributed in both target regions. Pst‐AFLP markers were equally distributed across both regions, while Eco‐AFLPs were clustered in the Scmv2 region.     

Maternal inheritance of cytoplasmic organelles in intergeneric hybrids of Carica papaya L. and Vasconcellea spp. (Caricaceae Dumort., Brassicales)

The mode of inheritance of chloroplast and mitochondrial DNA has been determined in intergeneric hybrids between C. papaya and four different Vasconcellea species by employing a restriction fragment length polymorphism analysis of a PCR-amplified chloroplast and mitochondrial DNA region. Artificial F₁ hybrids were produced between a female specimen of C. papaya and male specimens of either V. parviflora, V. goudotiana, V. cundinamarcensis or V. quercifolia. The hybridization patterns of all hybrids correspond in all cases with that of the C. papaya mother, and are different from that of the paternal Vasconcellea species, thus indicating the maternal inheritance of cpDNA and mtDNA in intergeneric hybrids between C. papaya and wild relatives of the Vasconcellea genus.     

Evaluation of seedling and adult plant resistance in European wheat cultivars to Australian isolates of <Emphasis Type="Italic">Puccinia striiformis</Emphasis> f. sp. <Emphasis Type="Italic">tritici</Emphasis>

A set of 105 European wheat cultivars was assessed for seedling resistance and adult plant resistance (APR) to stripe (yellow) rust in greenhouse and field tests with selected Australian isolates of Puccinia striiformis f. sp. tritici (Pst). Twelve cultivars were susceptible to all pathotypes, and among the remainder, 11 designated seedling genes (Yr1, Yr3, Yr4, Yr6, Yr7, Yr9, Yr17, Yr27, Yr32, YrHVII and YrSP) and a range of unidentified seedling resistances were detected either singly or in combination. The identity of seedling resistance in 43 cultivars could not be determined with the available Pst pathotypes, and it is considered possible that at least some of these may carry uncharacterised seedling resistance genes. The gene Yr9 occurred with the highest frequency, present in 19 cultivars (18%), followed by Yr17, present in 10 cultivars (10%). Twenty four cultivars lacked seedling resistance that was effective against the pathotype used in field nurseries, and all but two of these displayed very high levels of APR. While the genetic identity of this APR is currently unknown, it is potentially a very useful source of resistance to Pst. Genetic studies are now needed to characterise this resistance to expedite its use in efforts to breed for resistance to stripe rust. Colin R. Wellings seconded from NSW Department of Primary Industries.     

Variation of <Emphasis Type="Italic">Wx</Emphasis> microsatellite allele,waxy allele distribution and differentiation of chloroplast DNA in a collection of Thai rice (<Emphasis Type="Italic">Oryza sativa</Emphasis> L.)

Eighty-two varieties of rice from different regions in Thailand were selected to explore the Waxy (Wx)gene diversity and indica-japonica differentiation of chloroplast DNA. A comparison of the 5 splice site in the first intron was made between glutinous and nonglutinous rice. It revealed that non-glutinous with low-amylose content and glutinous rice were characterized as the Wx^b allele based on the G-to-T base substitution, whereas non-glutinous rice with intermediate and high amylose carried the Wx^a allele. Four Wx microsatellite alleles, (CT)_n repeat, (n = 16,17,18 and 19) were found in glutinous rice. In contrast, non-glutinous rice showed five Wx microsatellite alleles (n = 11, 16, 17, 18 and 19). The (CT)₁₇ allele was prominent allele in Thai population, while the (CT)₁₁ allele was found only in intermediate and high amylose rice varieties from southern Thailand. Almost all of upland rice grown by various ethnic groups in northern Thailand were characterized as japonica type based on their having the PstI-12 fragment in their cpDNA, whereas most of rainfed lowland varieties from other regions of Thailand were indica. This exploration of DNA-based genetic markers is important, as it enhances our ability to describe and manipulate sources of genetic variation for rice breeding programs.     

Intergeneric symmetric and asymmetric somatic hybridization in Festuca and Lolium

Summary Intergeneric symmetric and asymmetric somatic hybrids have been obtained by fusion of metabolically inactivated protoplasts from embryogenic suspension cultures of tall fescue (Festuca arundinacea Schreb.) and unirradiated or 10–500 Gy-irradiated protoplasts from non-morphogenic cell suspensions of Italian ryegrass (Lolium multiflorum Lam.). Genotypically and phenotypically different somatic hybrid Festulolium mature flowering plants were regenerated.Species-specific sequences from F. arundinacea and L. multiflorum being dispersed and evenly-represented in the corresponding genomes were isolated and used for the molecular characterization of the nuclear make-up of the intergeneric, somatic Festulolium plants recovered. The irradiation of Italian ryegrass protoplasts with 250 Gy X-rays prior to fusogenic treatment favoured the unidirectional elimination of most or part of the donor chromosomes. Irradiation of L. multiflorum protoplasts with 500 Gy produced highly asymmetric (over 80% donor genome elimination) nuclear hybrids and clones showing a complete loss of donor chromosomes.The RFLP analysis of the organellar composition in symmetric and asymmetric tall fescue (+) Italian ryegrass regenerants confirmed their somatic hybrid character and revealed a bias towards recipient-type organelles when extensive donor nuclear genome elimination had occurred.Approaches aimed at improving persistence of ryegrasses based on asymmetric somatic hybridization with largely sexually-incompatible grass species (F. rubra and Alopecurus pratensis), and at transferring the cytoplasmic male sterility trait by intra- and inter-specific hybridization in L. multiflorum and L. perenne, have been undertaken.Abbreviations cpDNA chloroplast DNA - CMS cytoplasmic male sterility - 2,4-D 2,4-dichlorophenoxy-acetic acid - IOA iodoacetamide - mtDNA mitochondrial DNA - RFLP restriction fragment length polymorphism     

RFLP variation and genetic relationships in cultivated cucumber

Summary Two sets of cucumber (Cucumis sativus L.) germplasm were used to determine the potential use of restriction fragment length polymorphisms (RFLPs) for estimating genetic relationships. Sixteen accessions [15 domesticated variety sativus and one feral variety hardwickii (PI 183967)] of diverse origin were used to assess RFLP variation in cucumber, and to determine if genetic relationships based on RFLPs were similar to those obtained by isozyme analysis. Additionally, 35 commercial lines or cultivars were surveyed to determine genetic relationships among and within common cucumber types (narrow genetic base). The 16 accessions were surveyed with 440 low copy clones from two libraries (Pst I partial genomic and cDNA) using two restriction enzymes. Data from a subset of 104 random (mapped and unmapped) and a set of 30 mapped RFLPs were used to estimate genetic relationships among the 16 cultigens. Variability was low among RFLPs (33% of all probes) and putative alleles ( 2.2 polymorphic fragments/probe). RFLP variation between sativus lines and hardwickii (21±4%) was greater than among sativus lines (12±2%). RFLPs among the 16 accessions revealed genetic relationships which agree with those obtained using isozymes. Genetic relationships estimated using mapped and unmapped RFLPs were similar. The 35 elite lines were surveyed using a set of 40 RFLPs from 3 libraries (Pst I and EcoR I partial genomic and cDNA) to evaluate the discriminatory value of RFLPs among and between commercial cucumber types. The RFLP-derived genetic relationships among this germplasm were in agreement with predictions based on fruit type and pedigree information. Thus, RFLPs are a useful addition to the morphological characters and isozyme loci currently used for taxonomic classification and plant variety protection of cucumber.     

RFLP characterization of Indian Musa germplasm for clonal identification and classification

Summary Nineteen single-copy clones isolated from a PstI genomic library (cv. Maiden Plantain), and eight Vigna chloroplast DNA clones were used to probe total genomic DNA digests of 57 genotypes of Musa from India. The 19 genomic clones detected a total of 107 polymorphisms among the 57 genotypes. Principal coordinates and phenetic analyses of these data placed cultivars and species into distinct groups that were in general agreement with a previously published RAPD-based classification of these same plant materials. The 107 polymorphisms were sufficient to differentiate each clone from every other clone. Heterologous Vigna chloroplast DNA probes were used to characterize the cytoplasm of Musa cultivars and species. PCO analysis of these RFLPs were detected both within and between the generally recognized genome groups, indicating multiple hybridization pathways in the origin of hybrid clones. Data presented demonstrate that RFLPs are sufficiently abundant to classify Musa germplasm and that genetic relationships among Musa cultivars, based upon RFLP data, are in general agreement with relationships determined by analysis of morphology and RAPDs.     

Overcoming hybridization barriers between pea and some of its wild relatives

Pea would benefit from the plasticity and adaptability of its cross-incompatible relatives Pisum fulvum and Lathyrus sativus L., and we have tested reciprocal sexual crossings by manually cross-pollinating plants of genotypes of these three species. Studies of in situ germination of pollen grains on stigmata showed that pollen tubes were generally unable to germinate or could not reach the ovary. A few putative hybrid pods were nevertheless harvested, with one grain per pod germinated in vitro, then micropropagated for flow cytometry, isoenzyme, molecular (ribosomal ITS PCR-RFLP) and genomic in situ hybridization (GISH) studies. One such grain was recovered from an inter-generic cross of P. sativum x L. sativus and four from an inter-specific P. sativum x P. fulvumcross. A strong cross-incompatibility was shown between pea and grass pea, where the putative hybrid turned out to be pea. Conversely, with the interspecific, P. sativum x P. fulvum cross, flow cytometry and isoenzymes with leaf tissues strongly suggested hybridity, while molecular approaches and GISH confirmed the production of inter-specific hybrids, and without the need for a wild type P. sativum accession as a bridging cross.     

Crossability relationships among Cajanus,atylosia and Rhynchosia species and detection of crossing barriers

Summary Crossability of two cultivars of Cajanus cajan, eight species of Atylosia and one of Rhynchosia was investigated. Of the 73 combinations attempted, success was achieved in 12 cases. C. cajan crossed successfully with A. albicans, A. cajanifolia, A. lineata, A. scarabaeoides, and A. trinervia. Within the genus Atylosia, A. lineata crossed with A. albicans and A. scarabaeoides, and A. scarabaeoides with A. sericea. Three species A. platycarpa, A. volubilis and R. rothii did not cross with any other one. In most of the unsuccessful combinations, although the pollen germinated on the receiving stigmas, the pollen tube growth was inhibited inside the stigma or in the stylar tissue.     

Mitochondrial DNA variation in finger millet (Eleusine coracana L. Gaertn)

Summary This study was conducted to classify 26 lines of finger millet from Africa and India into cytotype groups based on the Southern blot hybridization patterns obtained with maize and sorghum mitochondrial cloned gene probes. Five restriction endonuclease enzymes were used for single digestions on total cellular DNA, giving a total of 20 enzyme/probe combinations. There was a low level of polymorphism, with identical RFLP banding patterns in 23 of the 26 lines. However, mtDNA clone atp9 hybridized to a 3.6 Kb Xba1 fragment in ecotype SDFM-1143 from Malawi; but did not hybridize to a 3.0 Kb fragment present in all other ecotypes. Two Zimbabwean lines, SDFM 63 and SDFM 77, had an extra, low intensity 6.5 Kb Xba1 fragment hybridized by mtDNA clone cox1. This data enabled classification of the lines into 3 cytopype groups.     

SCAR and CAPS markers flanking the Brassica oleracea L. Pp523 downy mildew resistance locus demarcate a genomic region syntenic to the top arm end of Arabidopsis thaliana L. chromosome 1

We recently mapped the Pp523 locus that includes a single, dominant gene conferring resistance to downy mildew expressed in adult plants to a 75.1 cm long linkage group on a genetic linkage map of Brassica oleracea L. More recently, we identified a new AFLP marker 2.8 cm downstream from the resistance gene. The five DNA markers within an 8.5 cm region encompassing the Pp523 gene were cloned and sequenced. Three of these markers were transformed into SCARs (sequence characterised amplified regions), however, two among them were monomorphic and were analysed as CAPS (cleaved amplified polymorphic sequence) markers among the mapping population. Searched against genomic databases, the five B. oleracea DNA-marker sequences matched Arabidopsis thaliana L. gene sequences that delimit a conserved syntenic region in the top arm end of chromosome 1 of this last species. Considering the close genetic relatedness between both species, the information on this specific genomic region in A. thaliana is particularly useful for the construction of a fine-scale map of the corresponding genomic region in B. oleracea. The identified SCAR and CAPS markers can be used for marker assisted selection (MAS) in breeding programs aimed at the introgression of the Pp523 resistance locus, allowing the reliable indirect identification of plants harbouring the resistance gene with a margin of error of approximately six in ten-thousand selected plants.     

Ribosomal DNA repeat unit polymorphism and heritability in peanut (Arachis hypogaea L.) accessions and related wild species

Repeat unit length and restriction site variation in ribosomal RNA geneclusters (rDNA) was surveyed in 77 Arachis accessions, includingsamples from 39 accessions of cultivated Arachis hypogaea(2n=4x=40), 36 accessions representing 15 related tetraploid and diploidwild species, and two synthetic amphidiploids. Total genomic DNA wasdigested with five restriction enzymes, and probed with three heterologousribosomal clones of wheat and broad bean. Four rDNA repeat unit lengthclasses were recognized in the Arachis species. Restriction site analysisshowed that some SacI, BamHI and TaqI cleavage sites in rDNA unit werehighly conserved. With few exceptions, the variable BamHI and EcoRV siteswere able to differentiate the taxonomic sections and species, respectively.Arachis hypogaea and A. duranensis accessions produced fourrDNA length classes. Among these, three were identical with those of otherArachis species. A SacI restriction site (s) from probe (Ver6-5) cangenerally distinguish the two subspecies A. hypogaea ssp. hypogaea and A. hypogaea ssp. fastigiata. Forty nine per centof bands were polymorphic across the A. hypogaea accessionsanalysed. This study does not support A. batizocoi to be a progenitorof A. hypogaea. For the gene array, the contribution from eachparental genome can be detected in the two synthetic amphidiploids.