Chloroplast DNA diversity in brinjal eggplant (Solanum melongena L.) and related species

Chloroplast DNA (cpDNA) samples of brinjal eggplant (S. melongena) and representative related species including S. incanum sensu lato (or S. campylacanthum sensu stricto), S. lichtensteinii, S. marginatum, S. macrocarpon, S. anguivi and S. aethiopicum and also S. nigrum as an outgroup taxon, were digested by 14 restriction enzymes and analyzed by using electrophoresis and a cpDNA probe. All the species used here were clearly separated in the cpDNA analysis, except the pair S. anguivi and S. aethiopicum. From the dendrogram constructed by the unweighted pair-group method, it is suggested that S. incanum is the closest to S. melongena and the next closest species is S. macrocarpon followed by S. aethiopicum (and S. anguivi), S. lichtensteinii, S. marginatum and finally the outgroup taxon S. nigrum. The tree derived by the neighbour-joining method suggests phyletic relationships that agree with those indicated by crossability and seed coat anatomy, but conflict with conventional classifications based on morphology. In particular, members of sections Oliganthes and Melongena are not separated and no cpDNA variation was found within either of the morphologically diverse cultigens, S. aethiopicum and S. melongena. Paradoxically, the morphologically similar species S. incanum, S. lichtensteinii and S. marginatum have diverged greatly in their cpDNA. The significance of these results is discussed. This revised version was published online in July 2006 with corrections to the Cover Date.     

Chloroplast DNA diversity in eggplant (Solanum melongena) and its related species S. incanum and S. marginatum

Summary The potential of isozymes for distinguishing asparagus varieties was carried out by a survey on 21 varieties using 10 enzyme systems: GOT, SkDH, DIA, PGM, MDH, IDH, PGD, ACP, PGI, MR and ADH. Only 3 enzymes, SkDH, GOT and PGM, showed useful polymorphisms. The varieties were found heterogeneous according to their genetic structure: open pollinated varieties were more heterogeneous than clonal hybrids; the F1 hybrid and the vitroclones were homogeneous. As expected from the narrow genetic basis of the varieties, only a few alleles per isozyme locus were present. Moreover, for each enzyme, one allele or type was predominant so that the discriminating power of the method was low. However some of the varieties could be identified and different applications of the results are presented.Abbreviations D.U.S.- Distinction-Uniformity-Stability - ACO- aconitase - ACP- acid phosphatase - ADH- alcohol dehydrogenase - CAT- catalase - DIA- diaphorase - END- endopeptidase - GOT- glutamate oxaloacetate transaminase - IDH- isocitrate dehydrogenase - MDH- malate dehydrogenase - MR- menadione reductase - PGI- phosphoglucoisomerase - PGM- phosphoglucomutase - PGD- phosphoglucose dehydrogenase - POX- peroxidase - SkDH- shikimate dehydrogenase     

RFLP analysis of a PCR amplified region of chloroplast DNA in eggplant and related Solanum species

RFLP analysis of a PCR amplified 3.2-kbp region of cpDNA bounded by the conserved sequences in rbc L and ORF 106 was performed in eggplant (Solanum melongena), its related Solanum species, S. incanum, S. virginianum (= S. surattense), S. torvum, S. aethiopicum (= S. gilo), S. aethiopicum (= S. integrifolium), S. violaceum (= S. indicum), S. violaceum (= S. sanitwongsei) and S. mammosum and the reciprocal hybrids between S. aethiopicum (= S. integrifolium) and S. melongena 'Uttara'. The target region of cpDNA was amplified correctly by PCR. The amplified products were digested with each of 10 restriction enzymes (Alu I, Ase I, BamH I, Hinf I, Msp I, Rsa I, ScrF I, Sty I, Taq I and Xba I). Variations of restriction patterns among the species were recognized after digesting the amplified products with each of the seven restriction enzymes, Taq I, Alu I, Rsa I, Sty I, Ase I, Hinf I and Xba I. The restriction patterns divided the examined nine species into the following five clusters, 1) S. melongena and S. incanum, 2) S. virginianum (= S. surattense), 3) S. torvum, 4) S. aethiopicum (= S. gilo), S. aethiopicum (= S. integrifolium), S. violaceum (= S. indicum) and S. violaceum (= S. sanitwongsei) and 5) S. mammosum. The restriction pattern with Alu I in each of the reciprocal hybrids between S. melongena 'Uttara' and S. aethiopicum (= S. integrifolium) was identical with that of seed parent. The present study demonstrated the availability of the PCR-RFLP analysis of cpDNA for assessing taxonomic relationships and identifying cytoplasmic parentage of interspecific hybrids in eggplant and related Solanum species. This revised version was published online in July 2006 with corrections to the Cover Date.     

Chloroplast DNA variation in the wild potato species, Solanum acaule and S. albicans

The chloroplast DNA of Solanum acaule (109 accessions) and S. albicans (9 accessions) was investigated by restriction endonuclease analysis. Unexpectedly, all the accessions analyzed had C type chloroplast DNA in common. This suggested that S. acaule originated from a species with C type chloroplast DNA. DraI restriction digestion revealed further differentiation of C type chloroplast DNA into 8 types. The DraI polymorphism indicated the province of Salta in Argentina and the nearby regions to be a center of diversity for S. acaule. Surprisingly, S. albicans as well as S. acaule both ssp. acaule and ssp. punae, from Peru were virtually indistinguishable, although by morphology and/or cytology all three taxa are easily distinguished. This revised version was published online in July 2006 with corrections to the Cover Date.     

Determination of genetic variation and taxonomy in lentil (Lens Miller) species by chloroplast DNA polymorphism

Summary Chloroplast DNA restriction fragment lenght polymorphisms (RFLP) were used to examine the taxonomic relationships of cultivated and wild lentil (Lens Miller) species and identify the extent of genetic variation in this genus. Twelve accessions representing all Lens subspecies were digested with four hexanucleotide-recognizing restriction endonucleases. These digests randomly surveyed 540 base pairs, or 0.4% of the approximately 125 kilobase lentil chloroplast genome. A high degree of gragment length conservation was seen among members of crossability group I, i.e., L. c. ssp. culinaris, L. c. ssp. orientalis and L. c. ssp. odemensis. Accessions of the two subspecies comprising crossability group II, i.e., L. n. ssp. nigricans and L. n. ssp. ervoides, showed the greatest amount of variation when compared to the cultivated lentil, L. c. ssp. culinaris. Limited variation was observed within subspecies except for L. n. ssp. nigricans, where accessions of the normal cytotype were highly polymorphic to those of the differentiated cytotype. Chloroplast DNA RFLPs reaffirm hypotheses that propose L. c. ssp. orientalis as the progenitor to the cultivated lentil. The implications of this study on taxonomy and genetic resources is also discussed.     

Successful hybridization of non-tuberous Solanum etuberosum Lind. and tuberbearing S. pinnatisectum Dun.

The results of extensive crosses between the non-tuberous species Solanum brevidens and S. etuberosum on the one hand and ten tuber-bearing Solanum species on the other are presented. Three crosses gave rise to viable progeny. Two progenies consisted of diploid plants only of the strictly self-incompatible species of the mother parent. One cross, viz. S. etuberosum × S. pinnatisectum, produced highly vigorous but fully male sterile F₁ hybrids.It is suggested that this hybrid together with those between the tomato, Lycopersicon esculentum, and S, pennellii and S. lycopersicoides constitute piers of a bridge between tomato and potato species which in the future might enable gene transfer between these two crops via their wild relatives. However, such idea has to be treated with all proper reserve.The production of this new hybrid is the first step in making accessible to potato breeding the valuable genes which have been detected in S. brevidens and S. etuberosum, viz. the genes for high resistance to frost, leafroll and Y-virus.     

Gene transfer from non-tuberous to tuberous Solanum species: Evidence from meiosis in hybrids

Summary The distant hybrids between non-tuberous Solanum species and tuberous S. pinnatisectum display little or no pairing in F1 and predominantly bivalent formation (preferential pairing) after chromosome doubling. In such a situation the question about the potential and extent of gene transfer from the non-tuberous parent to the tuberous one is relevant to potato breeding. This question was investigated by studying meiosis in triploid and hexaploid hybrids from crosses between diploid TV⁵ x tetraploid (S. etuberosum x S. pinnatisectum). TV⁵ is similar to S. verrucosum with cytoplasm of S. tuberosum. The following evidence was found for the desirable transfer of S. etuberosum genes to the tuberous species.The triploid F1 hybrids did not display the configurations 12 II+12 I expected if no gene exchange would take place between S. etuberosum and the tuberous species; however, a considerable number of multivalents per cell was observed in all plants studied.In the hexaploid F1 hybrids, obtained from the triploids through somatic doubling in vitro, 36 bivalents could reasonably be expected. Although bivalents were predominant (an overall average of 24.2 per cell) quite a few chromosomes were associated as multivalents in all plants investigated.It is concluded that in the hybrids studied a considerable amount of pairing and chiasma formation occurs between chromosomes of non-tuberous and those of tuberous Solanum species. This pairing affinity is larger than that found in 2x and 4x hybrids from S. etuberosum x S. pinnatisectum. Some hypotheses are put forward to explain this increased pairing affinity.     

Colombia and Venezuela 1992 wild potato (Solanum sect. Petota) germplasm collecting expedition: taxonomy and new germplasm resources

Summary We conducted a joint Colombia/United States/Venezuela wild potato (Solanum sect. Petota Dumort.) germplasm collecting expedition in Colombia from June 27–August 24, and in Venezuela from August 17–September 15, 1992. The goals of the expedition were to collect germplasm and study the species boundaries of all of the 23 Colombian and Venezuelan taxa accepted by current taxonomists. We made 128 collections of 16 of these taxa, 96 as true seed collections. We collected the first available germplasm collections of S. cacetanum, S. cuatrecasasii, S. estradae, S. lobbianum, S. orocense, S. paramoense, and S. sucubunense, and obtained germplasm collections of S. neovalenzuelae and S. pamplonense as a germplasm exchange from the Colombian national germplasm collection. We had problems identifying some of our collections, and currently are investigating them for species status and interrelationships. We summarize the state of germplasm collections for Colombia and Venezuela, provide our field data regarding the taxonomy of Colombian and Venezuelan wild potatoes, and provide recommendations for future collecting.     

Estimating pollen fertility in Solanum species and haploids

Summary Three staining methods (acetocarmine, fuchsin and oxidation of benzidine) and germination in vitro and in vivo were applied to estimate pollen fertility in Solanum species and dihaploids. Pollen was divided into six classes based on shape and contents of the grains. With acetocarmine, fuchsin, peroxidase and germination in vitro 4, 3, 2 and 1 classes, respectively, are supposed to be included in the percentage of good pollen as measured by these methods. This percentage therefore, in more than 96% of the cases studied, shows a decrease in the order indicated. Neither aging of pollen at room conditions nor collecting pollen from flowers on 1–9 days after anthesis does influence the percentage of good pollen with acetocarmine and fuchsin, whereas this percentage drops sharply to zero with peroxidase and germination in vitro. The latter two methods apparently measure as good pollen only the grains with living cytoplasm. When pollen is collected at three successive dates from the same flowers the percentage of good pollen drops sharply with all methods used. There is a relation between quantity of pollen per flower and pollen quality (% good), low-quantity pollen containing significantly lower percentages of good pollen than medium- and high-quantity pollen. The latter two are not significantly different in this respect.From calculations of correlation coefficients it is concluded that only germination of pollen in vitro is significantly correlated with berry and seed set and thus gives a reliable estimate of male fertility. This does not hold true for the two staining methods without due reserve. The peroxidase method is not useful for the Solanum material studied.After standardized pollination the average number of haploid pollen grains on diploid stigmata was found to be 1625±127, that of diploid pollen on tetraploid stigmata 2863±98.A. W. B. Janssen 1975.     

Interspecific hybridization between Solanum melongena and Solanum macrocarpon: study of the F1 hybrid plants

Summary Egg plant is one of the most common vegetable crop grown in India and other parts of the world. The cultivated egg plant Solanum melongena is found to be susceptible to the shoot and fruit borer (Leucinodes orbonalis). Whereas the species Solanum macrocarpon is resistant. In order to incorporate the resistance of shoot and fruit borer to the cultivated egg plant, an interspecific hybridization between Solanum melongena and Solanum macrocarpon and reciprocals were carried out. The hybrids were found to be sterile, the investigations revealed that the failure of seed set in hybrids is due to the ovule abortion. In order to overcome the sterility, the colchicine has been applied to the interspecific hybrids.     

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. This revised version was published online in August 2006 with corrections to the Cover Date.     

Genetic relationships between Southern African Solanum retroflexum Dun. and other related species measured by morphological and DNA markers

In this study, the genetic relationship between 14 genotypes of black nightshade, most which were part of the Solanum nigrum complex, was investigated. Fifteen morphological characters were measured and used to compile a dendrogram. Amplified fragment length polymorphism (AFLP) markers were also used to assess the level of polymorphism between the 14 Solanum genotypes. Three EcoR I/Mse I primer combinations with three selective nucleotides per primer were used for screening the respective genotypes. Multiple polymorphisms could be detected to the extent that all the genotypes studied could be distinguished, using any single primer combination, thus showing the usefulness of AFLP's for this purpose. Up to 43 polymorphic bands were detected with a single primer combination among the 14 different genotypes. The three primer combinations generated a total of 359 bands, of which 222 (62%) were clearly polymorphic. This data was used to compile a dendrogram. Both the morphological and AFLP marker analysis clearly separated the different genotypes into similar groups. This revised version was published online in August 2006 with corrections to the Cover Date.     

The nature of the Bolivian weed potato species Solanum sucrense Hawkes

Summary Two theories for the origin of the Bolivian weed potato species Solanum sucrense Hawkes have been tested. The first was that it had an allopolyploid origin as a hybrid of the cultivated tetraploid S. tuberosum ssp. andigena (Juz. et Buk.) Hawkes with the wild/weed tetraploid cytotype of S. oplocense Hawkes. The second hypothesis postulated that it was a cross of the weed diploid species S. sparsipilum (Bitt.) Juz. et Buk. with S. oplocense.Synthetic hybrids of S. tuberosum ssp. andigena x S. oplocense and of S. sparsipilum x S. oplocense have been compared morphologically with S. sucrense accessions. Their crossability has also been investigated.The crossability and morphological studies strongly suggested that the former hypothesis was the more likely. This was borne out by observations made on the 1974 University of Birmingham Expedition when segregating populations of S. sucrense and S. oplocense were collected growing with feral S. tuberosum ssp. andigena.The evidence from this study indicates that the S. tuberosum ssp. andigena x S. oplocense hybrid has formed the basis of the S. sucrense gene pool. It is suggested that this hybridogenic taxon be maintained under the name Solanum x sucrense.The clarification of the taxonomic relationships of these three species will be of interest to Globodera resistance breeders, in view of the fact that these taxa are resistant to various pathotypes of the golden nematode.     

Frost tolerance in wild potato species: Assessing the predictivity of taxonomic, geographic, and ecological factors

The use of genetic resources could be more effective and efficient if we were able to predict the presence or absence of useful traits in different populations or accessions. We analyzed the extent to which taxonomic, geographic and ecological factors can predict the presence of frost tolerance in wild potatoes. We used screening data for 1646 samples from 87 species that had been collected in 12 countries in the Americas. There was a strong association of frost tolerance with species and to a lesser extent with taxonomic series. There was significant geographic clustering of areas with wild potatoes with similar levels of frost tolerance. Areas with a high level of frost tolerance are the central and southern Peruvian Andes, the lowlands of Argentina and adjacent areas, and a small area in the central Chilean Andes. There is a greater chance of finding wild potatoes with high levels of frost tolerance in areas with a yearly mean minimum temperature below 3 ^°C than there is in warmer areas. However, temperature is only a weak predictor of frost tolerance. Temperature data alone did not predict observed frost tolerance in eastern Argentina/Uruguay and falsely predicted it in the southwestern United States. Because many wild potato species occur over small areas, taxonomic, ecological, and geographical factors are difficult to disentangle. This revised version was published online in July 2006 with corrections to the Cover Date.     

Ribosomal DNA repeat unit polymorphism and heritability in peanut (Arachis hypogaea L.) accessions and related wild species

Repeat unit length and restriction site variation in ribosomal RNA geneclusters (rDNA) was surveyed in 77 Arachis accessions, includingsamples from 39 accessions of cultivated Arachis hypogaea(2n=4x=40), 36 accessions representing 15 related tetraploid and diploidwild species, and two synthetic amphidiploids. Total genomic DNA wasdigested with five restriction enzymes, and probed with three heterologousribosomal clones of wheat and broad bean. Four rDNA repeat unit lengthclasses were recognized in the Arachis species. Restriction site analysisshowed that some SacI, BamHI and TaqI cleavage sites in rDNA unit werehighly conserved. With few exceptions, the variable BamHI and EcoRV siteswere able to differentiate the taxonomic sections and species, respectively.Arachis hypogaea and A. duranensis accessions produced fourrDNA length classes. Among these, three were identical with those of otherArachis species. A SacI restriction site (s) from probe (Ver6-5) cangenerally distinguish the two subspecies A. hypogaea ssp. hypogaea and A. hypogaea ssp. fastigiata. Forty nine per centof bands were polymorphic across the A. hypogaea accessionsanalysed. This study does not support A. batizocoi to be a progenitorof A. hypogaea. For the gene array, the contribution from eachparental genome can be detected in the two synthetic amphidiploids.     

Distribution,ecology and reproductive biology of wild tomatoes and related nightshades from the Atacama Desert region of northern Chile

Over the past 20 years, several expeditions were made to northern Chile to collect populations of wild tomatoes (Solanum chilense, S. peruvianum) and allied nightshades (S. lycopersicoides, S. sitiens), and obtain information about their geographic distribution, ecology and reproductive biology. Restricted mainly to drainages of the Andean and the coastal cordillera, populations are geographically fragmented. The two nightshade species are rare and threatened by human activities. Adaptation to extreme aridity and soil salinity are evident in S. chilense and S. sitiens (the latter exhibits several xerophytic traits not seen in the tomatoes) and to low temperatures in S. lycopersicoides and S. chilense. All tested accessions are self-incompatible, with the exception of one S. peruvianum population collected at the southern limit of its distribution. Several distinguishing reproductive traits—anther color, attachment, and dehiscence, pollen size, and flower scent—suggest S. sitiens and S. lycopersicoides attract different pollinators than S. chilense and S. peruvianum. The four Solanum spp. native or endemic to Chile provide a variety of novel traits which, through hybridization and introgression with cultivated tomato, could facilitate development of improved varieties, as well as research on a variety of basic topics, including plant-pollinator interactions, abiotic stress responses, and evolution of reproductive barriers.     

Application of DNA fingerprints for identification and genetic analysis of Carica papaya and other Carica species

Summary Various DNA fingerprint probes were applied to Carica papaya and other Carica species for both identification and genetic analysis.Each of the Carica papaya cultivars is characterized by a specific DNA fingerprints pattern. Various Carica species also have specific patterns which distinguish them from one another. Band sharing levels were used to estimate the relatedness between the various Carica species.Genetic analysis of 11 progeny from a cross between the Carica papaya cultivars 17/82 and 112 suggests that application of DNA fingerprinting to Carica papaya breeding, could make the process more efficient. Genetic analysis of the DNA fingerprint bands revealed no linkage or allelic relationship among the bands analyzed, indicating that these loci are not clustered in the Carica genome.     

Unique meiotic behaviourin F1 plants from a cross between a non-tuberous and a tuberous Solanum species in section Petota

Uniformly abnormal meiotic behaviour was observed in 12 F₁-plants from a cross between Solanum etuberosum (non-tuberous) and S. pinnatisectum (tuberous). Per pollen mother cell at MI an average was found of 3.64 bivalents (all rodshaped, 1–2 per cell, heteromorphic), 16.64 univalents (scattered haphazardly on a continuous bipolar spindle) and 0.03 trivalents (all Y-shaped). Lagging chromosomes and precocious division of univalents very frequently occurs, leading to unequal distribution of chromosomes, aneuploid gametes and male sterility. Heteromorphic bivalents at MI, loops in bivalents at pachytene and non-disjunction in one hybrid plant, point to a highly abnormal meiotic behaviour. The occurrence of few trivalents is discussed.Considering that according to the literature nearly normal pairing was observed in the intergeneric F₁-hybrids Lycopersicon esculentum × Solanum lycopersicoides and L. esculentum x S. pennellii, the lack of chromosome pairing in an interspecific F₁-hybrid, of which both Solanum parents belong to the same section, is paradoxical to a plant breeder and might even be conspicuous to a taxonomist.     

PCR-RFLP analysis of the whole chloroplast DNA from three cultivated species of cotton (Gossypium L.)

Variations of the chloroplast DNA (cpDNA) from three of the four cultivated species of cotton (Malvaceae); Gossypium barbadense L., Gossypium hirsutum L., Gossypium arboreum L. and its synonym Gossypium nanking Meyen., were analyzed. Using specific set of primers, the whole circular cpDNAs from the four test species were amplified. These were subsequently digested with the use of seven restriction enzymes. The amplified fragments of the whole cpDNAs of the diploid cultivated cotton G. arboreum and its synonym G. nanking did not show any differences. However, the allotetraploid cultivated cottons G. barbadense and G. hirsutum, showed some fragment length differences directly visible after amplification and two types of restriction fragment length polymorphism (RFLP), the first appeared as slightly lengthened bands and the other as gain or loss of a restriction site. The results also showed that the chloroplast genomes of the allotetraploid cultivated cottons are highly similar to the diploid cultivated cottons tested in terms of length and digestion patterns. The detected amplified length differences, RFLPs and the restriction sites can be considered as species specific markers for the allotetraploid cultivated cottons, which could be a useful tool for future studies of the cpDNA of the genus Gossypium L.     

Analysis of glutamate oxaloacetate transaminase (GOT) isozyme variants in diploid tuberous Solanum; inheritance and linkage relationships to ds1 (desynapsis), y (tuber flesh colour), cr (crumpled) and yc (yellow cotyledon)

Summary Employing polyacrylamide gradient-gel electrophoresis, the genetic control of leaf glutamate oxaloacetate transaminase (GOT) isozyme variants and their linkage to ds1 (desynapsis), y (tuber flesh colour), cr (crumpled) and yc (yellow cotyledon) were studied in diploid tuberous Solanum species hybrids.Leaf GOT isozymes proved to be dimeric and under the control of two independently segregating loci (Got-1 and Got-2) with two (1 ^s , 1 ^f ) and three (2 ^s , 2 ^f , 2 ⁿ )alleles respectively. The 2 ⁿ allele was concluded to encode a 2 ^fallozyme subunit capable of forming heterodimeric but no homodimeric active molecules. As expected with Got-1 and Got-2 isozymes being localized in different cellular compartments, no intergenic heterodimer formation was observed.In contrast to earlier studies, a gradual rather than discrete transition between the tuber flesh colour classes white and yellow was observed in segregating progenies. Adopting a standardized classification method, however, monogenic recessive inheritance of white tuber flesh was confirmed. Got-1, ds1 and cr were found to represent a single linkage group. Among the presently studied marker loci no further linkages were detected. As to linkage analysis, the difficulties imposed by gametophytic incompatibility in nearly all diploid potato species and by the frequent occurrence of recessive (sub)lethal genes are discussed.