Stimulation of 24,25-dihydroxyvitamin D3 production by 1,25-dihydroxyvitamin D3

Vitamin D-deficient rats produce [(3)H]1,25-dihydroxyvitamin D(3) from [(3)H]25-hydroxyvitamin D(3) regardless of dietary content of calcium or phosphate. A daily dose of 130 picomoles of 1,25-dihydroxyvitamin D(3) for a period of 5 days reduces production of [(3)H]1,25-dihydroxyvitamin D(3) to essentially zero and stimulates production of [(3)H]24,25-dihydroxyvitamin D(3). A daily dose of 325 picomoles of 25-hydroxyvitamin D(3) has a similar but less dramatic effect. On the other hand, 650 picomoles daily of 24,25-dihydroxyvitamin D(3) given to vitamin D-deficient rats had no effect. Thus it appears that 1,25-dihydroxyvitamin D(3) is an important factor in the regulation of kidney metabolism of 25-hydroxyvitamin D(3).     

1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone

The hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], at picomolar concentrations, inhibited the growth-promoting lymphokine interleukin-2, which is produced by human T lymphocytes activated in vitro by the mitogen phytohemagglutinin. Other metabolites of vitamin D3 were less effective than 1,25(OH)2D3 in suppressing interleukin-2; their order of potency corresponded to their respective affinity for the 1,25(OH)2D3 receptor, suggesting that the effect on interleukin-2 was mediated by this specific receptor. The proliferation of mitogen-activated lymphocytes was also inhibited by 1,25(OH)2D3. This effect of the hormone became more pronounced at later stages of the culture. These findings demonstrate that 1,25(OH)2D3 is an immunoregulatory hormone.     

Target cells for 1,25-dihydroxyvitamin D3 in intestinal tract, stomach, kidney, skin, pituitary, and parathyroid

After mature rats that had been fed on a vitamin D3-deficient diet were injected with tritium-labeled 1,25-dihydroxyvitamin D3, radioactivity became concentrated in nuclei of luminal and cryptal epithelium of the duodenum, jejunum, ileum, and colon; in nuclei of the epithelium of kidney distal tubules including the macula densa, and in podocytes of glomeruli; in nuclei of the epidermis including outer hairshafts and sebaceous glands; and in nuclei of certain cells of the stomach, anterior and posterior pituitary, and parathyroid. These results reveal cell types that contain receptors for 1,25-dihydroxyvitamin D3 or metabolites of this compound both in known or hypothesized target tissues and in tissues that were previously unknown to participate in vitamin D3 metabolism.     

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.     

Vitamin D in solution: conformations of vitamin D3, 1alpha,25-dihydroxyvitamin D3, and dihydrotachysterol3

Solution conformations of the A and seco B rings of vitamin D(3), 1(alpha), 25-dihydroxyvitamin D(3), 1(alpha)-hydroxyvitamin D(3), and dihydrotachysterol(3) have been established by high resolution, 300-megahertz proton magnetic resonance spectroscopy. The A ring of these steroids is dynamically equilibrated between two chair conformers. For vitamin D(3), 1(alpha)-hydroxyvitamin D(3), and 1(alpha),25-dihydroxyvitamin D(3) the relative proportions of the two conformers are 1 : 1, whereas dihydrotachysterol3 exists principally as only one conformer. Thus, the substituent groups on the A ring may be either equatorially or axially oriented, and suggests a refinement of the existing topological model for vitamin D hormonal activity.     

Radioreceptor assay for 1 alpha,25-dihydroxyvitamin D3

A competitive protein binding assay with a sensitivity of 80 picograms has been developed for 1alpha,25-dihydroxyvitamin D(3), the hormonal form of vitamin D(3). lalpha,25-Dihydroxyvitamin D(3) displaced tritiated hormone from a cytosol-chromatin receptor preparation isolated from chick small intestine, providing a simple assay for the hormone. The concentration of lalpha, 25-dihydroxyvitamin D(3) in human plasma, as determined by this assay, is approximately 6 nanograms per 100 milliliters; in patients with renal disease the concentration of this kidney-produced hormone is significantly lower.     

1,25-dihydroxycholecalciferol: metabolite of vitamin D3 active on bone in anephric rats

Nephrectomy prevents completely the bone calcium mobilization response to 25-hydroxycholecalciferol. In contrast it does not prevent this response to 1,25-dihydroxycholecalciferol. Because it is known that the kidney is the site of 1,25-dihydroxycholecalciferol formation, these results provide evidence that 1,25-dihydroxycholecalciferol or a further metabolite thereof and not 25-hydroxycholecalciferol is the metabolically active form of vitamin D(3) responsible for bone calcium mobilization.     

1 alpha, 25-Dihydroxyvitamin D3 nuclear receptors in pituitary

Specific binding of 1 alpha,25-dihydroxyvitamin D(3) was found in nuclear and cytosol fractions of the bovine pituitary. For nuclear binding. the dissociation constant was 0.1 namomole per liter, and maximum binding was 104 femtomoles per milligram of protein. In competition studies, 25-hydroxyvitamin D(3) was 300 times weaker than 1 alpha,25-dihydroxyvitamin D(3). The existence of high-affinity sites supports a physiologic role for 1 alpha,25-dihydroxyvitamin D(3) in the pituitary.     

Aryl hydrocarbon hydroxylase induction in human leukocytes

A method for determining aryl hydrocarbon hydroxylase induction in human leukocytes is described. Leukocytes from healthy volunteers were cultured in the presence of phytohemagglutinin, a mitogen. Addition of 3-methylcholanthrene to 72-hour cultures induced a fourfold increase in aryl hydroxylase activity. In the absence of a mitogenic agent, 3-methylcholanthrene stimulation of increased enzymatic activity did not occur.     

Structure of the human dopamine D3 receptor in complex with a D2/D3 selective antagonist

Dopamine modulates movement, cognition, and emotion through activation of dopamine G protein-coupled receptors in the brain. The crystal structure of the human dopamine D3 receptor (D3R) in complex with the small molecule D2R/D3R-specific antagonist eticlopride reveals important features of the ligand binding pocket and extracellular loops. On the intracellular side of the receptor, a locked conformation of the ionic lock and two distinctly different conformations of intracellular loop 2 are observed. Docking of R-22, a D3R-selective antagonist, reveals an extracellular extension of the eticlopride binding site that comprises a second binding pocket for the aryl amide of R-22, which differs between the highly homologous D2R and D3R. This difference provides direction to the design of D3R-selective agents for treating drug abuse and other neuropsychiatric indications.     

Lactic dehydrogenase and metabolism of human leukocytes in vitro

During transformation and division of lymphocytes in culture, the lactic dehydrogenase isozymes migrate increasingly toward the cathode. With extension of the time in culture, the mitotic index declines, and the isozyme pattern reverts to dominance of those bands that move toward the anode, despite the cellular tendency to anaerobic metabolism. These findings suggest that synthesis of the more slowly migrating lactic dehydrogenase isozymes in this system is related to mitotic activity, and not to the aerobic or anaerobic conditions of cell culture.     

N-Formylmethionyl peptide receptors on equine leukocytes initiate secretion but not chemotaxis

The chemotaxis of leukocytes appears to be initiated by the binding of chemotactic factors to the surface of these cells. N-Formylated peptides induce chemotaxis and lysosomal enzyme secretion of leukocytes; because these peptides are available in a purified radiolabeled form, they have been useful in the characterization of receptors for chemotactic factors. Equine polymorphonuclear leukocytes secrete lysosomal enzymes but do not exhibit chemotaxis in respone to the N-formylated peptides, even though they have a high-affinity cell surface receptor for these agents. The specificity of the equine receptor resembles the specificity of the receptor on chemotactically responsive leukocytes from other species. Equine polymorphonuclear leukocytes may thus be an excellent model for the study of the events that lead to a biological response following receptor occupancy.     

Nucleus accumbens D2/3 receptors predict trait impulsivity and cocaine reinforcement

Stimulant addiction is often linked to excessive risk taking, sensation seeking, and impulsivity, but in ways that are poorly understood. We report here that a form of impulsivity in rats predicts high rates of intravenous cocaine self-administration and is associated with changes in dopamine (DA) function before drug exposure. Using positron emission tomography, we demonstrated that D2/3 receptor availability is significantly reduced in the nucleus accumbens of impulsive rats that were never exposed to cocaine and that such effects are independent of DA release. These data demonstrate that trait impulsivity predicts cocaine reinforcement and that D2 receptor dysfunction in abstinent cocaine addicts may, in part, be determined by premorbid influences.     

Stimulation by phagocytosis of the deiodination of L-thyroxine in human leukocytes

Intact human leukocytes actively deiodinate L-[(131)1] thyroxine, producing mainly inorganic (131)1 and chromatographically immobile (131)1-labeled origin material. When phagocytosis is induced, the deiodination is enhanced, a suggestion that deiodination in mediated by a peroxidase-hydrogen peroxide system. l-Thyroxine can serve as a source of iodine for iodination reactions within the leukocyte.     

Extracting 3D from motion: differences in human and monkey intraparietal cortex

We compared three-dimensional structure-from-motion (3D-SFM) processing in awake monkeys and humans using functional magnetic resonance imaging. Occipital and midlevel extrastriate visual areas showed similar activation by 3D-SFM stimuli in both species. In contrast, intraparietal areas showed significant 3D-SFM activation in humans but not in monkeys. This suggests that human intraparietal cortex contains visuospatial processing areas that are not present in monkeys.     

Bone resorbing activity in supernatant fluid from cultured human peripheral blood leukocytes

A new soluble mediator was found in supernatant fluid from cultures of human peripheral blood leukocytes that were stimulated by phytohemagglutinin, or by antigenic material present in human dental plaque deposits. This soluble Jactor produced bone resorption in organ cultures of fetal rat bones as measured by increased release of calcium-45, and also increased the number of active osteoclasts.     

Putative melatonin receptors in a human biological clock

In vitro autoradiography with 125I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific 125I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific 125I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completely inhibited specific 125I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.     

Water-soluble insulin receptors from human lymphocytes

Specific insulin receptors from human lymphocytes in culture have been prepared in aqueous solution without use of detergents or related compounds. Receptors prepared in this fashion exhibit characteristics identical to those reported in intact cells.