Reduced height (Rht) and photoperiod insensitivity (Ppd) allele associations with establishment and early growth of wheat in contrasting production systems

Near isogenic lines (NILs) varying for genes for reduced height (Rht) and photoperiod insensitivity (Ppd-D1a) in a cv. Mercia background (rht (tall), Rht-B1b, Rht-D1b, Rht-B1c, Rht8c + Ppd-D1a, Rht-D1c, Rht12) were compared at one field site but within contrasting (‘organic’ vs. ‘conventional’) rotational and agronomic contexts, in each of 3 years. In the final year, further NILs (rht (tall), Rht-B1b, Rht-D1b, Rht-B1c, Rht-B1b + Rht-D1b, Rht-D1b + Rht-B1c) in both Maris Huntsman and Maris Widgeon backgrounds were added together with 64 lines of a doubled haploid (DH) population [Savannah (Rht-D1b) × Renesansa (Rht-8c + Ppd-D1a)]. Assessments included laboratory tests of germination and coleoptile length, and various field measurements of crop growth between emergence and pre jointing [plant population, tillering, leaf length, ground cover (GC), interception of photosynthetically active radiation (PAR), crop dry matter (DM) and nitrogen accumulation (N), far red: red reflectance ratio (FR:R), crop height, and weed dry matter]. All of the dwarfing alleles except Rht12 in the Mercia background and Rht8c in the DHs were associated with reduced coleoptile length. Most of the dwarfing alleles (depending on background) reduced seed viability. Severe dwarfing alleles (Rht-B1c, Rht-D1c and Rht12) were routinely associated with fewer plant numbers and reduced early crop growth (GC, PAR, DM, N, FR:R), and in 1 year, increased weed DM. In the Mercia background and the DHs the semi-dwarfing allele Rht-D1b was also sometimes associated with reductions in early crop growth; no such negative effects were associated with the marker for Rht8c. When significant interactions between cropping system and genotype did occur it was because differences between lines were more exaggerated in the organic system than in the conventional system. Ppd-D1a was associated positively with plant numbers surviving the winter and early crop growth (GC, FR:R, DM, N, PAR, height), and was the most significant locus in a QTL analysis. We conclude that, within these environmental and system contexts, genes moderating development are likely to be more important in influencing early resource capture than using Rht8c as an alternative semi-dwarfing gene to Rht-D1b.     

Population genetic structure of the clonal plant Zingiber zerumbet (L.) Smith (Zingiberaceae), a wild relative of cultivated ginger, and its response to Pythium aphanidermatum

Zingiber zerumbet (L) Smith, a wild clonal species related to the cultivated ginger (Zingiber officinale Roscoe), is a potential resistance donor for soft rot disease in ginger caused by Pythium aphanidermatum (Edson) Fitzp. In this study we evaluated the genetic diversity and P. aphanidermatum resistance of 74 Z. zerumbet accessions belonging to 15 populations from eight districts in Kerala state, India. The disease index (DI) of the accessions varied from 0% to 72.24% and the accessions could be separated into six frequency classes according to their DI values. More than 65% of the accessions had a DI < 20%. Eight accessions were found to be immune to the infection. The relative frequency of resistant accessions was higher in the central and northern regions of Kerala. Amplified fragment length polymorphism (AFLP) analysis of Z. zerumbet accessions using five primer combinations yielded 215 bands in total, of which 175 (81.4%) were polymorphic. Nei’s genetic diversity (h) of 0.2738 and Shannon information index (I) of 0.4012 revealed a high genetic diversity in Z. zerumbet unexpected for a clonal species. In the UPGMA dendrogram, accessions were clustered mostly according to their geographical origin and no clear correspondence was observed between the clustering pattern of accessions and their responses to Pythium aphanidermatum. The study revealed high genetic diversity and variability for pathogen resistance among Z. zerumbet accessions and confirmed the value of Z. zerumbet as a potential donor for soft rot resistance for the genetic improvement of ginger.     

Progenies of allotriploids of Oriental × Asiatic lilies (Lilium) examined by GISH analysis

With the aim of utilizing allotriploid (2n = 3x = 36) lily hybrids (Lilium) in introgression breeding, different types of crosses were made. First, using diploid Asiatic lilies (2n = 2x = 24), reciprocal crosses (3x − 2x and 2x − 3x) were made with allotriploid hybrids (AOA) obtained by backcrosses of F₁ Oriental × Asiatic hybrids (OA) to Asiatic cultivars (A). Secondly, the AOA allotriploids were crossed with allotetraploid (OAOA, 2n = 4x = 48), in 3x − 4x combination. Finally, the AOA allotriploids where crossed to 2n gamete producer F₁ OA hybrids (3x − 2x (2n)). Two types of triploids were used as parents in the different types of crosses, derived from: (a) mitotic polyploidization and (b) sexual polyploidization. Ploidy level of the progeny was determined by estimating the DNA values through flowcytometry as well as chromosome counting. The aneuploid progeny plants from 3x − 2x and reciprocal crosses had approximate diploid levels and in 3x − 4x crosses and 3x − 2x (2n) the progeny had approximate tetraploid levels. Balanced euploid gametes (x, 2x and 3x) were formed in the AOA genotypes. Recombinant chromosomes were found in the progenies of all crosses, except in the case of 2x − 3x crosses through genomic in situ hybridization (GISH) analyses. Recombinant chromosomes occurred in the F₁ OA hybrid when the triploid AOA hybrid was derived through sexual polyploidization, but not through mitotic polyploidization with two exceptions. Those recombinant chromosomes were transmitted to the progenies in variable frequencies.     

Cytogenetic analyses of sugarcane relatives (Andropogoneae: Saccharinae)

Summary Meiosis was studied in 31 wild Saccharum relatives, including Erianthus (8 clones), Miscanthus (5 clones), Narenga prophyrocoma (1 clone), S. robustum (3 clones), and S. spontaneum (14 clones). Chromosome number for 18 clones confirmed published counts or was typical of the particular species. Chromosome number for seven clones (Djatiroto 2n=58, Molokai 5099 2n=80, SES 84/58 2n=58, SES 114 2n=64, SES 260 2n=64, Taiwan 100 2n=112, and US 57-11-2 2n=60) differed from published counts (2n=112, 86-100, 64, 60, 60, 96, and 30, respectively). Counts were obtained for the first time for six clones (Local escape 2n=96, Nepal 2n=72, NG 77-77 2n=108–112, NG 77-199 2n=166, US 57-60-2 2n=20, and US 68-1-4 2n=38). Bivalent chromosome pairing predominated in all clones. Meiotic irregularity (numeric aberrations, univalents, multivalents, and telophase II micronuclei) tended to be associated with taxonomic grouping and level of polyploidy. Clones in Erianthus, Miscanthus, and Narenga were apparent euploids (2n=20–60) and tended to have fewer meiotic irregularities than Saccharum clones. Differences in level of meiotic stability among taxonomic groups may reflect error in chromosome association and synapsis associated with high chromosome number.     

Inheritance of trichomes and resistance to pod borer (Helicoverpa armigera) and their association in interspecific crosses between cultivated pigeonpea (Cajanus cajan) and its wild relative C. scarabaeoides

The legume pod borer, Helicoverpa armigera, is one of the most devastating pests of pigeonpea. High levels of resistance to pod borer have been reported in the wild relative of pigeonpea, Cajanus scarabaeoides. Trichomes (their type, orientation, density and length) and their exudates on pod wall surface play an important role in the ovipositional behavior and host selection process of insect herbivores. They have been widely exploited as an insect defense mechanism in number of crops. In the present investigation, inheritance of resistance to pod borer and different types of trichomes (A, B, C and D) on the pod wall surface in the parents (C. cajan and C. scarabaeoides) and their F₁, F₂, BC₁ (C. cajan × F₁), and F₃ generations has been studied. Trichomes of the wild parents (high density of the non-glandular trichomes C and D, and glandular trichome B and low density of glandular trichome A) were dominant over the trichome features of C. cajan. A single dominant gene as indicated by the segregation patterns individually will govern each trait in the F₂ and backcross generation. Segregation ratio of 3 (resistant): 1 (susceptible) for resistance to pod borer in the F₂ generation under field conditions was corroborated with a ratio of 1:1 in the backcross generation, and the ratio of 1 non-segregating (resistant): 2 segregating (3 resistant: 1 susceptible): 1 non-segregating (susceptible) in F₃ generation. Similar results were obtained for pod borer resistance under no-choice conditions. Resistance to pod borer and trichomes associated with it (low density of type A trichome and high density of type C) are governed individually by a dominant allele of a single gene in C. scarabaeoides. Following backcrossing, these traits can be transferred from C. scarabaeoides into the cultivated background.     

Identification of self-incompatibility (S) alleles in Latvian and Swedish sweet cherry genetic resources collections by PCR based typing

The Latvian and the Swedish sweet cherry (Prunus avium L.) genetic resources collections comprise valuable material for breeding. The collections represent local Latvian and Scandinavian genetic resources: semi-wild samples, landraces, and cultivars developed in local breeding programmes, as well as diverse germplasm from the northern temperate zone. The objective of this investigation was to determine which S ₁ –S ₆ alleles are most important in the sweet cherry genetic resources collections and to compare the identified allelic and genotypic frequencies in material of different origin. Accessions in the two collections were screened for the presence of the self-incompatibility (S) S ₁ to S ₆ alleles, using PCR based typing. Significant differences (P < 0.05) between screened collections were found in frequencies of S ₄ and S ₅ alleles. Analysis of allele combinations identified the high occurrence of selections with the S-genotype S ₃ S ₆ in both collections. Compared to the S-allele frequencies published for over 250 sweet cherry cultivars from Western and Southern Europe, the Latvian and Swedish germplasm appeared to have a high frequency of the S ₆ allele in both collections, and a relatively high frequency of the S ₅ allele in Latvian germplasm. This study represents the first comprehensive S-allele screening for the sweet cherry genetic resources collections in Latvia and Sweden. Both sweet cherry collections contain high proportion of accessions adapted to north central European growing conditions, not typical for the majority of the documented sweet cherry genetic resources, which explains differences in certain S-allele occurrence.     

Karyotype analysis and interspecific hybridisation in three perennial Sesbania species (Leguminosae)

Summary The somatic chromosome number in Sesbania sesban var. nubica, S. goetzei and S. keniensis (Leguminosae; Papilionoidae) was found to be 2n=12. These findings were in agreement with earlier reports on S. sesban and S. keniensis. The chromosome number 2n=12 is a new record for S. goetzei. Similarities in karyotypes were found in the three species. All species had one pair of long metacentric chromosomes; the second pair was submedian, followed by four smaller pairs of metacentric chromosomes. Nucleolar organiser regions in the form of satellites were found on the short arm of the fourth chromosome pair in S. sesban and S. keniensis. Interspecific crosses in all possible combinations were carried out, resulting in pod and viable seed formation for the crosses S. sesban x S. goetzei, S. sesban x S. keniensis, S. goetzei x S. sesban and S. goetzei x S. keniensis. The two crosses with S. keniensis as a female parent were unsuccessful. The hybrid plants established normally and produced viable seeds.     

Genetic basis of pod borer (Helicoverpa armigera) resistance and grain yield in desi and Kabuli Chickpea (Cicer arietinum L.) under unprotected conditions

A series of half-diallel crosses involving early, medium and late maturity desi and kabuli type chickpea (Cicer arietinum L.) genotypes with stable resistance to Helicoverpa pod borer, along with the parents, were evaluated at two locations in India to understand the inheritance of pod borer resistance and grain yield. Inheritance of resistance to pod borer and grain yield was different in desi and kabuli types. In desi type chickpea, the additive component of genetic variance was important in early maturity and dominance component was predominant in medium maturity group, while in the late maturity group, additive as well as dominance components were equally important in the inheritance of pod borer resistance. Both dominant and recessive genes conferring pod borer resistance seemed equally frequent in the desi type parental lines of medium maturity group. However, dominant genes were in overall excess in the parents of early and late maturity groups. In the kabuli medium maturity group, parents appeared to be genetically similar, possibly due to dispersion of genes conferring pod borer resistance and susceptibility, while their F₁s were significantly different for pod borer damage. The association of genes conferring pod borer resistance and susceptibility in the parents could be attributed to the similarity of parents as well as their F₁s for pod borer damage in kabuli early and late maturity groups. Grain yield was predominantly under the control of dominant gene action irrespective of the maturity groups in desi chickpea. In all the maturity groups, dominant and recessive genes were in equal frequency among the desi parental lines. Dominant genes, which tend to increase or decrease grain yield are more or less present in equal frequency in parents of the early maturity group, while in medium and late maturity groups, they were comparatively in unequal frequency in desi type. Unlike in desi chickpea, differential patterns of genetic components were observed in kabuli chickpea. While the dominant genetic component was important in early and late maturity group, additive gene action was involved in the inheritance of grain yield in medium duration group in kabuli chickpea. The dominant and recessive genes controlling grain yield are asymmetrically distributed in early and medium maturity groups in kabuli chickpea. The implications of the inheritance pattern of pod borer resistance and grain yield are discussed in the context of strategies to enhance pod borer resistance and grain yield in desi and kabuli chickpea cultivars.     

Species relationships in the subgenus Ceratotropis (genus Vigna) as revealed by RAPD analysis

Summary The genetic variation among 23 accessions of 5 species in the subgenus Ceratotropis, genus Vigna, were investigated by random amplified polymorphic DNA (RAPD) analysis. A total of 404 fragments amplified with 24 primers were scored and analyzed by cluster analysis. The accessions used were separated into two main groups with an average of 70% differences. Within the main groups, five subgroups were recognized, which are in complete agreement with taxonomic species. Wild forms were always grouped with their most closely related cultivated forms and they showed variation in each species. The largest intraspecific variation was found in V. radiata (mungbean), in which wild forms (V. radiata var. sublobata) were highly different from each other and from cultivated forms. V. angularis (adzuki bean) showed the least variation and thus, was probably differentiated in relatively recent times.     

A possible gene source for early,day-length neutral pigeon peas,Cajanus cajan (L.) Millsp.

Summary Atylosia scarabaeoides Benth. and A. platycarpa Benth., close relatives of the species Cajanus cajan (L.) Millsp., were screened for photoperiodic response. Four photoperiods ranging from 12 h 45 min to 19 h were studied in three environments. A. scarabaeoides flowered freely only in the first photoperiod. A. platycarpa not only flowered early (39 to 63 days after planting) in all four photoperiods, but also exhibited a relatively constant vegetative phase up to 16 h of illumination. Cajanus cajan, in which most cultivars-if not all-exhibit a response to photoperiod, was successfully hybridized with the two Atylosia species. It is suggested that genes for earliness and insensitivity to day-length could be transferred from A. platycarpa to C. cajan.     

The reproductive biology of three perennial Sesbania species (Leguminosae)

Summary The reproductive biology of Sesbania sesban, S. goetzei and S. keniensis (Leguminosae; Papilionoideae) was studied. Fifty percent flowering was observed at 102 to 153 days after germination for S. sesban accessions; 96 to 146 days for S. goetzei and 131 to 176 days for S. keniensis accessions. Flowers opened in the afternoon and remained fresh for 2–3 days. Bee species including Xylocopa sp., Apis mellifera, Megachile bituberculata and Chalicodoma sp. visited the flowers. Hand pollination experiments showed that all three species were self and cross compatible. The percentage of fully developed seeds was greater in pods formed after cross pollination compared to self pollination. No evidence was found for stigmatic or stylar self incompatibility. Outcrossing is probably the common method of reproduction under natural conditions, although in isolated trees substantial seed set by selfing might occur. Pod production under natural conditions was 34% for S. sesban; 49% for S. goetzei and 39% for S. keniensis. Considerable variation was found in pod production under open pollination between accessions of the same species. Selective abortion was observed within pods, with more mature seeds formed at the distal end of the pod.     

Physico-chemical traits of Cajanus cajan (L.) Millsp. pod wall affecting Melanagromyza obtusa (Malloch) damage

Pigeonpea [Cajanus cajan (L.) Millsp.] is an important legume crop in the semi-arid tropics, and pod fly [Melanagromyza obtusa (Malloch)] is an important emerging constraint to increase the production and productivity of this crop under subsistence farming conditions. Host plant resistance can be used as an important tool for the management of this pest. Therefore, a set of ten pigeonpea genotypes from a diverse array of plant growth types and maturity groups including two appropriate commercial checks, was evaluated for resistance to pod fly under field conditions, and characterized for physico-chemical pod traits. The non-determinate type GP 75 (extra early maturing) and GP 118 (early maturing), and determinate type GP 233 (extra early maturing) and GP 253 (early maturing) genotypes had significantly lower pod and seed damage as compared to determinate (Prabhat) and non-determinate (Manak) early maturing checks, suggesting that resistance to pod fly is not linked to plant growth type and maturity period of the genotype in pigeonpea. Pod wall thickness, trichome density, reducing and non-reducing sugars, total phenols, tannins, and crude fiber were found to be negatively associated (r = −0.83** to −0.97**), while total protein positively associated (r = 0.88** to 0.97**) with pod fly infestation. Therefore, these traits particularly total phenols, tannins, crude fiber, trichome density, and pod wall thickness, can be used as physico-chemical markers to identify pigeonpea genotypes with resistance to M. obtusa, and use in pod fly resistant breeding program in pigeonpea.     

Identification of AFLP fragments linked to one recessive genic male sterility (RGMS) in rapeseed (Brassica napus L.) and conversion to SCAR markers for marker-aided selection

117AB is a recessive genic male sterility (RGMS) line in which the sterility is controlled by a duplicate recessive gene named ms, located at two separate loci. In the RGMS line, the genotype of the sterile plant (117A) is msmsmsms, and that of the fertile plant (117B) is Msmsmsms. The present study was aimed to identify DNA markers linked to the ms locus by amplified fragment length polymorphism (AFLP). From the survey of 512 AFLP primer combinations, 6 AFLP fragments (y1, k1, k2, k3, k4, k5) were identified as being tightly linked to the Ms locus. The genetic distances between the markers and the Ms locus were all less than 8 cM, among which two fragments, designated as k2 and k3, co-segregated with the target gene in the tested population. Fragment k2 was successfully converted into a sequence characterized amplified region (SCAR) marker. The markers detected could be valuable in marker-assisted breeding of RGMS in Brassica napus.     

Molecular cytogenetic characterization of wheat-Thinopyrum ponticum translocations bearing blue-grained gene(s) induced by r-ray

Eight γ-irradiation-induced Triticum aestivum – Thinopyrum ponticum translocations conveying the blue aleurone were characterized using molecular cytogenetic approach. The size of alien chromosome segments was estimated by genomic in situ hybridization (GISH). The wheat chromosome segments involved in these translocations were clearly identified by two-color fluorescence in situ hybridization (FISH) with the probes of pAs1 and pSc119.2 (or pHvG38). Most of the detected translocations were reciprocal translocations involving wheat chromosomes 1B, 2D, 3A, 4A, 5B, 6B, 6D and 7A. This series of blue-grained wheat translocation lines would be useful in theoretical studies and wheat chromosome engineering breeding.     

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. This revised version was published online in August 2006 with corrections to the Cover Date.     

Inheritance of downy mildew resistance at cotyledon and adult-plant stages in ‘Couve Algarvia’ (Brassica oleracea var. tronchuda)

Parasitic nematodes damage white clover (Trifolium repens) roots, negatively impacting forage yield and persistence. No single gene resistance to nematodes has been identified in white clover. Trifolium semipilosum (2n = 2x = 16) genotypes exhibiting either complete resistance or susceptibility to infection by the clover root-knot nematode (CRKN), Meloidogyne trifoliophila, were identified. F₁ progeny (n = 92) of a pair-cross between ‘TsR’, a plant heterozygous for the resistance phenotype and ‘TsS’, a plant homozygous for the susceptible phenotype, were challenged with infective CRKN juveniles and evaluated subsequently for root galling. Segregation analysis indicated the resistance phenotype may be conferred by a single dominant allele at a locus (designated TRKR, Trifolium Root-knot Resistance) subject to segregation distortion. TsR, TsS, and bulked resistant and bulked susceptible F₁ progeny (n = 12/bulk) were screened using T. repens microsatellite (SSR) markers. Three SSRs revealed polymorphism in TsR and the resistant bulk, of which prs090 and prs247 map to loci on T. repens linkage group D2. Progeny were genotyped with these three SSRs and 23 additional SSRs from T. repens groups D1 and D2. Linkage analysis in both TsR and TsS demonstrated macro-synteny between T. repens group D homoeologues and the T. semipilosum linkage group (designated D_Ts) containing the TRKR locus. Significant segregation distortion was detected in TsR, and recombination in the central region of the T. semipilosum linkage group was suppressed relative to T. repens in both parents. These data demonstrate the opportunities and challenges for comparative mapping in Trifolium and characterisation of loci conferring resistance to plant-parasitic nematodes.     

Cytogenetical studies in wheat XIX. Location and linkage studies on gene Yr27 for resistance to stripe (yellow) rust

The stripe (yellow) rust resistance gene Yr27 was located in wheat (Triticum aestivum L.) chromosome 2B and shown to be closely linked to the leaf (brown) rust resistance genes Lr13 and Lr23 in the proximal region of the short arm. Gene Yr27 was genetically independent of Lr16, which is distally located in the same arm. While Yr27 was often difficult to score in segregating seedling populations, it is apparently quite effective in conferring resistance to avirulent cultures under field conditions. The occurrence of Yr27 in Mexican wheat germplasm and the current over-dependence on Yr27 for crop protection in Asia are discussed.     

A novel source of resistance to the two-spotted spider mite in Lycopersicon pimpinellifolium (Jusl.) Mill.: its genetics as affected by interplot interference

We have previously found an accession of Lycopersicon pimpinellifolium (Jusl.) Mill. (`TO-937') that appeared to resist attack by the two-spotted spider mite (Tetranychus urticae Koch). L. pimpinellifolium is a very close relative of the cultivated tomato (Lycopersicon esculentum Mill.) and thereby a potential source of desirable traits that could be introgressed to the crop species. The objective of this study was to investigate the genetics of the resistance present in `TO-937'. Resistance to infestation by the spider mite was quantified in 24-plant plots of L. pimpinellifolium accessions `TO-937' and `PE-10', L. pennellii accession `PE-45', L. esculentum cultivars `Moneymaker', `Roma' and `Kalohi' (reported to be partially resistant: Stoner & Stringfellow, 1967), and the interspecific F₁ cross, L. esculentum `Moneymaker' × L. pimpinellifolium `TO-937'. Only `TO-937', the F<sub>1</sub>, and`PE-45' were found to be resistant. Resistance of `TO-937' was complete when evaluated in two small greenhouses completely planted with `TO-937' so as to simulate the genotypic homogeneity usual in commercial crops. Generations (P₁, P₂, F₁, F₂, BC₁P₁, and BC₁P₂) of a P₁ (susceptible) × P₂ (resistant) cross (`Moneymaker' × `TO-937') were studied for resistance in a single-plant per plot design. Resistance of `TO-937' was inherited with complete dominance and appeared to be controlled by either two or four genes according to whether segregation in the F₂ or the BC₁P₁, respectively, were considered. However, calculation of the number of genes involved in the resistance was complicated by negative interplot interference due to the high frequency of resistant genotypes within most of the generations. This revised version was published online in July 2006 with corrections to the Cover Date.     

In vitro techniques for selecting wheat (Triticum aestivum L.) for Fusarium-resistance. II. Culture filtrate technique and inheritance of Fusarium-resistance in the somaclones

Summary Calli of resistant, intermediary and susceptible wheat (Triticum aestivum L.) varieties were selected using culture filtrates of Fusarium graminearum and F. culmorum and the regenerants were evaluated for resistance up to R₃. Czapek-Dox broth medium was inoculated with mycelia of Fusarium isolates and incubated for 2–6 weeks. Filtrates were added to MS callus growing medium, then 5 weeks-old calli were transferred onto this medium (MST) for 4–5 weeks. MST containing 30% filtrate was found to be suitable for selection. Resistant calli were transferred again to fresh MST for further two selection cycles. The surviving calli produced less fertile regenerated lines (R₀) than the non-selected ones. Among 18 R₁ lines tested for Fusarium-resistance in the seedling stage by artificial inoculation in the greenhouse, two (11.1%) were significantly more resistant, one (5.6%) was more susceptible than the original cultivar and the rest (83.3%) behaved similarly to the donor plants. Among unselected R₃ lines of three varieties, practically the same number of resistant plants were found as among the related selected ones. When the R₃ selfed generations obtained through double-layer and culture filtrate selection techniques were tested for Fusarium-resistance, 35.7% of the lines were found to be more resistant than the original cultivars, none was more susceptible and 64.3% had a reaction similar to that of the source materials. Thus, inheritance of the disease reaction was not stable in all cases. Success of in vitro selection for Fusarium-resistance depended also on the genotype, and toxin analysis showed that although being effective, the selective media contained deoxynivalenol only exceptionally. In selecting wheat for Fusarium-resistance in vitro, the culture filtrate technique proved better than the double-layer procedure.     

Integration of transgenes into sexual polyploidization schemes for potato (Solanum tuberosum L.)

Most potato transgenic research has focused on development of resistance to pathogens and modification of potato physiology. Many transgenes, particularly those conferring pathogen resistance, could substantially lower potato production costs in developing countries. However, transgenes have not been reported in sexually propagated 4x-2x potato hybrids commonly grown in developing countries. Two transgenes,the Bacillus thuringiensis cry3Aa endotoxin protein gene and the PVY°coat protein gene, were engineered intodiploid and tetraploid potato using Agrobacterium tumefaciens-mediated transformation. Cry3Aa was produced at high levels in several lines while the PVY° coat protein was not expressed. Diplandroid and tetraploid genotypes were crossed to produce transgenic 4x-2x hybrids. Genetic transformation had no discernable effect on fertility ofthe primary transformants, germination of4x-2x seed derived from the transformants and agronomic performance(tuber set, average tuber weight and total tuber yield) of the 4x-2xhybrids. The transgenic 4x-2xhybrids produced non-viable pollen and could only be crossed as female parents. Results suggest that transgenes, such ascry3Aa, could be expressed in 4x-2x hybrids to lower costs of production with no significant effect on plant phenotype. This revised version was published online in July 2006 with corrections to the Cover Date.