Patterns of longitudinal and tangential maturation stresses in Eucalyptus nitens plantation trees

Context

Tree orientation is controlled by asymmetric mechanical stresses set during wood maturation. The magnitude of maturation stress differs between longitudinal and tangential directions, and between normal and tension woods.

Aims

We aimed at evaluating patterns of maturation stress on eucalypt plantation trees and their relation with growth, with a focus on tangential stress evaluation.

Methods

Released maturation strains along longitudinal and tangential directions were measured around the circumference of 29 Eucalyptus nitens trees, including both straight and leaning trees.

Results

Most trees produced asymmetric patterns of longitudinal maturation strain, but more than half of the maturation strain variability occurred between trees. Many trees produced high longitudinal tensile stress all around their circumference. High longitudinal tensile stress was not systematically associated with the presence of gelatinous layer. The average magnitude of released longitudinal maturation strain was found negatively correlated to the growth rate. A methodology is proposed to ensure reliable evaluation of released maturation strain in both longitudinal and tangential directions. Tangential strain evaluated with this method was lower than previously reported.

Conclusion

The stress was always tensile along the longitudinal direction and compressive along the tangential direction, and their respective magnitude was positively correlated. This correlation does not result from a Poisson effect but may be related to the mechanism of maturation stress generation.     

Pulmonary alveolar microlithiasis in an alpaca (Vicugna pacos)

Pulmonary alveolar microlithiasis (PAM) is a rare, familial disease of unknown aetiology characterised by intra‐alveolar formation and accumulation of microliths. Multiple formalin‐fixed tissues were submitted from a 5‐month‐old female alpaca that died suddenly without significant clinical signs. No gross abnormalities were observed on postmortem examination. Histological findings included PAM and severe centrilobular hepatic necrosis. Although the hepatic lesion was the likely cause of death, PAM was an incidental finding that has not been reported previously in alpacas. An overview of PAM, including pathogenesis and histopathological characteristics, are discussed in relation to the concurrent hepatic disease in the present case.     

Energy supply interruptions and national security

Vulnerability to oil supply interruptions poses serious threats to the U.S. economy and the life-style of its citizens. The Iranian cutbacks in 1979 resulted in price increases of 120 percent in 1 year and gasoline lines across the country. Creation and use of ample public and private stocks could moderate price increases after another interruption and prevent disruption of supplies. Use of the marketplace to allocate shortages, coupled with rebates to cushion blows to the economy and hardship to individuals, would be eminently more efficient than government allocation programs. International cooperation, through coordination of stock buildup and withdrawal, could mitigate the damage from oil disruptions among all the Western nations.     

Mitotane (o, DDD) resistance in a dog with pituitary-dependent hyperadrenocorticism and phaeochromocytoma

A dog was presented with a 2 year history of polyuria and polydipsia due to pituitary-dependent hyperadrenocorticism. A low-dose dexamethasone suppression test and measurement of plasma ACTH concentration confirmed the diagnosis. Treatment was instituted with mitotane at 44 mg/kg/day and then 88 mg/kg/d without complete resolution of signs. The dog collapsed with signs consistent with liver disease and was euthanased. Necropsy revealed a phaeochromocytoma of the left adrenal medulla with extensive metastases to the liver. A chromophobe adenoma of the pars intermedia of the pituitary was found.     

Mechanical analysis of the strains generated by water tension in plant stems. Part I: stress transmission from the water to the cell walls

Plant tissues shrink and swell in response to changes in water pressure. These strains can be easily measured, e.g., at the surface of tree stems, to obtain indirect information about plant water status and other physiological parameters. We developed a mechanical model to clarify how water pressure is transmitted to cell walls and causes shrinkage of plant tissues, particularly in the case of thick-walled cells such as wood fibers. Our analysis shows that the stress inside the fiber cell walls is lower than the water tension. The difference is accounted for by a stress transmission factor that depends on two main effects. The first effect is the dilution of the stress through the cell wall, because water acts at the lumen border and is transmitted to the outer border of the cell, which has a larger circumference. The second effect is the partial conversion of radial stress into tangential stress. Both effects are quantified as functions of parameters of the cell wall structure and its mechanical properties.     

Use of azadirachtin as a larvicide or feeding deterrent for control of western flower thrips in orchard systems

Field trials were carried out to assess the efficacy of a 4% azadirachtin (aza)-containing neem seed extract EC, against damage by western flower thrips [Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae)] on nectarine crops in the Similkameen Valley, British Columbia, Canada. Several trials were conducted during the years 1993 to 1995 to assess the repellent and larvicidal properties of aza, specifically: whether it was effective against adult or larval thrips; how the effects differed with concentration of aza; and whether female WFT avoided aza-treated flowers. Our results showed that aza has only limited effectiveness as a control agent against WFT on nectarines and the current formulation does not appear to limit larval development sufficiently to be deemed a possible control agent in this field situation.     

Fungal infection of the eyes of the snake Epicrates chenchria maurus: enucleation under halothane narcosis

In a rainbow boa (Epicrates chenchria maurus) an affection of the spectacle of the eyes caused by the fungus Fusarium oxysporum is described for the first time. Enucleation was performed under premedication of Hypnodil and inhalation anesthesia with tracheal intubation, using Halothane. Résumé. On décrit, pour la première fois, chez le boa Epicrates chenchria maurus une affection des paupières transparentes causée par le fongus Fusarium oxysparum. L'énucléation a été faite sous prémédication d'Hypnodil et d'inhalation anesthésie avec intubation trachéale, utilisant Halothane. Zusammenfassung. In einer Boa, Epicrates chenchria maurus, wurde eine Erkrankung von der durchsichtigen Kapsel über dem Auge, verursacht durch den Fungus Fusarium oxysporum zum ersten Ma1 beschrieben. Enukleation wurde vorgenommen, unter Basisnarkose van Hypnodil und Einatmungsanästhesie mit trachealer Intubation, indem man Halothane gebrauchte.     

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.