Simulated effects of browsing on the production and economic values of Scots pine (Pinus sylvestris) stands

Effects of browsing damage on Scots pine (Pinus sylvestris) production and economic value were simulated on sites ranging in fertility from relatively poor to relatively high. Effects of browsing damage on growth and survival after trees had exceeded browsing-height were estimated using data from a browsing study. Stem lists were produced when stems had reached a height of about 4?m. Individual tree data were then imported into the Heureka simulation system to generate predictions about stand production and economic value. Six browsing levels were simulated: 0, 2, 5, 10, 15 and 27% browsing damage annually. The 2% and 5% browsing levels had only minor effects on production, whilst higher browsing levels significantly reduced production. However, the effect on economic value was more pronounced and even the 2% browsing level had significant effects on estimated land expectation values. Results from this simulation may support discussions about acceptable browsing levels in young Scots pine stands.     

Production process for high-quality pea-protein isolate with low content of oligosaccharides and phytate

A process for pea-protein isolate production, resulting in low content of phytate and oligosaccharides, has been developed. Oligosaccharides were removed from the protein fraction through ultrafiltration. Ultrafiltration of 50- and 100-kD molecular-weight cutoffs (MWCOs) were tested, and both effectively separated the oligosaccharides from the protein. Phytate degradation was achieved by incubation of the pea-protein solution by addition of exogenous phytase enzyme. An almost complete degradation of inositol hexa-, penta-, tetra-, and triphosphates was reached using an incubation time of 1 h. The reduced content of oligosaccharides and inositol phosphates is likely to result in reduced flatulence and improved mineral bioavailability. These qualities of the pea-protein isolate make it a suitable protein source for infant formula production.     

The Importance of Including the pH Dependence of Sulfate Adsorption in a Dynamic Soil Chemistry Model

Sulfate adsorption is an important process when modeling the dynamics of recovery from acidification. In the dynamic soil chemistry model SAFE sulfate adsorption is modeled by a pH and sulfate concentration dependent isotherm. This isotherm has been parameterized by fitting it to data from batch experiments on soil samples using multiple linear regression. The soil samples were from the B-horizon from three sites, two from the Lake Gårdsjön area in south-west Sweden and one from southern Poland. The pH dependency of sulfate adsorption is important. The batch experiments show that the adsorbed amount, at a specific sulfate concentration, increases considerably with decreasing pH. This implies that the adsorbed pool of anthropogenic sulfate in soils may remain fairly high during the recovery phase. Although a decrease of sulfate concentration is commonly seen, the modeled pH increase is often slow, and thus delays in the modeled desorption of anthropogenic sulfate can be expected.     

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.     

The influence of fencing on seedling establishment during reforestation of oak stands: a comparison of artificial and natural regeneration techniques including costs

European Journal of Forest Research - In temperate Europe, oak-dominated forests are widespread, supporting high biodiversity and providing important ecosystem services. Insufficient natural...     

Whole-genome shotgun sequencing of mitochondria from ancient hair shafts

Although the application of sequencing-by-synthesis techniques to DNA extracted from bones has revolutionized the study of ancient DNA, it has been plagued by large fractions of contaminating environmental DNA. The genetic analyses of hair shafts could be a solution: We present 10 previously unexamined Siberian mammoth (Mammuthus primigenius) mitochondrial genomes, sequenced with up to 48-fold coverage. The observed levels of damage-derived sequencing errors were lower than those observed in previously published frozen bone samples, even though one of the specimens was >50,000 14C years old and another had been stored for 200 years at room temperature. The method therefore sets the stage for molecular-genetic analysis of museum collections.